NCERT Solutions Class 12 Biology Chapter 6
NCERT Solutions Class 12 Biology Chapter 6
The study of living beings, their origins, anatomy, morphology, physiology, behaviour, and distribution is called biology. It is a broad-ranging natural science with various unifying elements that unite it as a single, cohesive topic. In the past, there was a phrase for biology in English called lifelore, but it is no longer used.
NCERT Class 12 Biology Chap 6: The Molecular Basis of Inheritance.Â
The study of genes is part of the molecular foundation of heredity. DNA as genetic material, DNA replication, transcription, translation, genetic code, gene expression control, and many other topics are covered in the research. As you've read, DNA has a double-helical structure, which was discovered in the 1950s by James Watson and Francis Crick using their theory, model, and experiment. Each strand of DNA helix is made up of nucleotide repeating units.
Chapter 6 Class 12 Biology is a study of genetics. Students may find it a little challenging to get a hold of  this chapter. Extramarks lends a helping hand by providing NCERT Solutions Class 12 Biology Chapter 6. These Solutions will give students an idea of the answer writing pattern for the upcoming board examinations and further guide them with the help of sample papers, notes, so that they can be confident in their preparation and add to their academic excellence.
Extramarks offers students a variety of study materials to choose from. In addition, they can access study materials for all classes. Material such as NCERT books, CBSE revision notes, CBSE sample papers, CBSE previous year question papers, and more are available at Extramarks official website.
Key Topics Covered in NCERT Solutions Class 12 Biology Chapter 6
Mentioning below the key concepts covered in NCERT Solutions Class 12 Biology Chapter 6- Molecular basis of Inheritance:
| What is DNA? |
| Structure of Polynucleotide |
| Talking about a Gene |
| Packaging DNA Helix |
| RNA World |
| Genetic Code |
| Regulation of Gene Expression |
 Extramarks' briefly explains each subtopic in NCERT Solutions Class 12 Biology Chapter 6- Molecular Basis of Inheritance.
What is DNA?
DNA, or deoxyribonucleic acid, is the molecule of heredity in all living beings since it conveys genetic information. It's a lengthy deoxyribonucleotide polymer chain. The amount of nucleotide base pairs in it determines its length.
Based on X-ray crystallography of DNA, Watson and Crick were the first scientists to suggest a double-helical model for the molecule. Every strand of DNA is made up of nucleotides, each of which comprises deoxyribose sugar, a nitrogen base, and a phosphate.
According to the central dogma of molecular biology, genetic information passes from DNA to RNA to Protein.
The whole structure of DNA resembles a twisted ladder. Weak hydrogen bonds between the nitrogen bases hold the two strands of DNA together. Purine bases always couple with pyrimidine bases, such as adenine (A) with thymine (T) and guanine (G) with cytosine (C).
Students can refer to NCERT Solutions Class 12 Biology Chapter 6 for a detailed explanation of DNA and its aspects. In addition, they can register with Extramarks to access concise, authentic study material in abundance.
Structure of Polynucleotide
NCERT Solutions Class 12 Biology Chapter 6 explains the structure of Polynucleotide in the following section.
The three constituents that make up a nucleotide are the nitrogenous base, sugar, and phosphate group. Purines (Adenine and Guanine) and Pyrimidines are nitrogenous bases (Cytosine and Thymine). The pentose sugar (ribose in RNA and deoxyribose in DNA) makes up the sugar portion, while the nucleoside and nucleotide make up the phosphate group.
Talking about a Gene
NCERT Solutions Class 12 Biology Chapter 6 describes that the functional unit of Inheritance is the gene. DNA comprises both coding and non-coding nucleotide sequences in all eukaryotic species. Exons and introns are the terms for coding and non-coding sequences, respectively. The Exons are visible in mature RNA, while the introns are not.
RNA stands for Ribonucleic Acid. It is a single strand of nucleic acid found in all living cells that serves as a messenger for DNA's instructions on protein synthesis regulation. The three main kinds of RNA molecules are:
- Ribosomal RNA (rRNA)
- Messenger RNA (mRNA)
- Transfer RNA (tRNA)
Packaging DNA Helix
- In prokaryotes, DNA is organised in a massive loop in the nucleoid region, with positively charged proteins holding negatively charged DNA tightly.
- In prokaryotes, DNA is organised in chromosomes in a complicated manner. First, DNA is twisted around the centre of a histone octamer (a unit with eight histone molecules) to create a nucleosome.
- Positively charged proteins in the form of histones, which are high in the essential amino acids lysine and arginine, have been discovered. H1, H2A, H2B, H3, and H4 are the five kinds. The histone octamer comprises two molecules of four histone proteins that are important for gene regulation.
- The nucleosome is a chromatin repeating unit that prevents DNA from tangling and contains about 200 bp of DNA.
- NHC makes it easier for chromatin to be packaged further (Non-histone chromosomal proteins).
- Euchromatin: Euchromatin is a transcriptionally active region with loosely packed chromatin that absorbs light stains.
- Heterochromatin: Heterochromatin is a transcriptionally dormant region with tightly packed chromatin that absorbs the black dye.
RNA World
NCERT Solutions Class 12 Biology Chapter 6 states that RNA was the initial genetic material, and there is sufficient evidence to show that critical life processes originated around it. It is employed as a genetic material as well as a catalyst. However, as a catalyst, RNA was extraordinarily reactive and hence unstable. As a result, DNA developed from RNA, with chemical changes that made it more stable.
Replication
- Watson and Crick presented a semiconservative model for DNA replication.
- Meselson and Stahl demonstrated that DNA replicated semi-conservatively in 1958.
- Taylor established that DNA replication is semiconservative in another experiment on faba beans (Vicia faba) using radioactive thymidine.
- Enzyme DNA replication is catalysed by DNA polymerase. Only in the 5'3' direction can it polymerise.
- Replication is continuous in a strand with a 5 '3' direction, referred to as the leading strand, with a 3' 5' polarity, referred to as the leading strand template.
- When using a trailing strand template with a polarity of 5'3', replication is interrupted.
Transcription
NCERT Solutions Class 12 Biology Chapter 6 describes that only one section of the genetic information in DNA gets transcribed into RNA. In RNA, instead of Thymine, Adenine interacts with Uracil. The structural gene, promoter, and terminator are all involved in DNA transcription. Transcription is catalysed by RNA polymerase, and the direction of transcription is the same as that of replication by DNA polymerase, i.e. 5'3'. The antisense strand template strand has a 3'5' polarity and is a template for RNA synthesis. The coding strand, also known as a sense strand, has a polarity of 5'3'. It also has a structural gene, a promoter, a terminator, exons, and introns.
Genetic Code
These are the base sequences in mRNA that code for a particular amino acid in protein production. Every code is made up of three nucleotides called triplets. There are 64 codons in all, with 61 coding for amino acids. The remaining three are called stop codons since they do not code for any amino acids. For example, the start codon, AUG, also codes for the amino acid methionine.
Mutations and Genetic Code
Point mutation is caused by a change in a single base pair. For example, sickle cell anaemia is caused by a mutation in the gene that codes for the -globin chain. As a result, Glutamate in the normal protein is changed to Valine in the sickle cell. When one or two base pairs are lost or gained, the reading frame at the location of deletion or insertion is altered. A frameshift mutation is a term for this type of mutation.
Translation
NCERT Solutions Class 12 Biology Chapter 6 explains Translation as the polymerisation of amino acids. Peptide bonds link amino acids together. The three RNAs (mRNA, tRNA, and rRNA) play a unique function in the translation process. The aminoacylation of tRNA is the first step in the translation process. Ribosomes catalyse the synthesis of peptide bonds, operating as a protein-making factory. The translation procedure is always in the 5'3' direction. The large subunit of a ribosome has two places where two tRNAs with amino acids near enough to form a peptide bond can be accommodated.
Regulation of Gene Expression
- In eukaryotes, the expression of a gene that produces polypeptide can be controlled at many levels:Â
- When the primary transcript, i.e. transcription, is created.
- At the time of splicing or processing.
- When mRNA is being transported from the nucleus to the cytosol.
- When it comes to protein synthesis or translation.
- Environmental, physiological, and metabolic factors all influence gene expression.
- The coordinated control and expression of numerous genes are responsible for the embryo's growth and differentiation.
- In prokaryotes, gene expression is mainly controlled at the transcriptional start.
- Regulatory proteins, which can be repressors or activators, control the activity of RNA polymerase at the start site.
- The promoter region's accessibility is controlled by a neighbouring operator sequence that binds to a particular protein, usually a repressor. In a specific operator, there is a particular operator and repressor protein.
NCERT Solutions Class 12 Biology Chapter 6 Exercise and Solutions
Extramarks' website is well known for its unique and upgraded quality study material such as previous year's question papers, revision notes, extra problems, and more are available for all the classes. Click on the links below to view NCERT Solutions Class 12 Biology Chapter 6:
- Class 12 Biology Chapter 6: Very Short Answer Type Questions
- Class 12 Biology Chapter 6: Short Answer Type Questions
- Class 12 Biology Chapter 6: Long Answer Type Questions
Students can access NCERT Solutions Class 12 Biology Chapter 6 and other chapters by clicking here. In addition, students can also explore NCERT Solutions for other classes below.
- NCERT Solutions Class 1
- NCERT Solutions Class 2
- NCERT Solutions Class 3
- NCERT Solutions Class 4
- NCERT Solutions Class 5
- NCERT Solutions Class 6
- NCERT Solutions Class 7
- NCERT Solutions Class 8
- NCERT Solutions Class 9
- NCERT Solutions Class 10
- NCERT Solutions Class 11
- NCERT Solutions Class 12
By getting access to NCERT Solutions Class 12 Biology Chapter 6, students can easily understand all the concepts relating to the Molecular Basis of Inheritance.
Key Features of NCERT Solutions Class 12 Biology Chapter 6
Students are widely advised to go through the NCERT solutions to catch the fundamentals of the chapter. Extramarks NCERT Solutions are pretty popular among students and teachers. Not convinced? Try out on your own. Â Here are some reasons why you should choose Extramarks:
- When students follow NCERT Solutions diligently, they will be able to understand every concept and answer questions easily. This encourages the students to master the topic and increases their confidence in achieving a higher grade. Â
- Extramarks NCERT Solutions is written in an easy to understand language by the subject matter experts. It is a thoroughly researched material made in sync with CBSE examination guidelines. When students study from it, they will get an edge over their peers.
- NCERT solutions are available online on Extramarks’ website and app.It is the most appreciated and trustworthy site. Students need not browse through other apps since Extramarks has built that credibility and is trusted by lakhs of students across India.
Q.1 Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine
Ans-
| Nitrogenous Bases | Nucleosides |
| Adenine, Cytosine, Thymine, Uracil | Cytidine, Guanosine |
Explanation: A nucleotide has three components: a nitrogenous base, a pentose sugar (ribose in case of RNA and deoxyribose in case of DNA) and a phosphate group. A nitrogenous base is linked to the pentose sugar through N-glycosidic linkage to form a nucleoside.
Q.2 If the double stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.
Ans-
If the double-stranded DNA has 20 percent of cytosine, the percent of adenine in the DNA would be 30%.
Explanation: As a rule no. of A= no. of T and no. of G = no. of C. Also, A+T=G+C. The bases in the two strands are paired through hydrogen bond (H-bonds) forming base pairs. Cytosine forms three H-bonds with Guanine that means if Cytosine is 20%, Guanine is also 20%. This leaves 60% for Adenine and Thymine which are paired through two H-bonds. Thus, Adenine would be 30%.
Q.3 If the sequence of one strand of DNA is written as follows:
5′ -ATGCATGCATGCATGCATGCATGCATGC-3′
Write down the sequence of complementary strand in 5’→3′ direction.
Ans-
The sequence of the complementary strand in 5’to 3’direction:
5’-GCATGCATGCATGCATGCATGCATGCAT -3’
Explanation: The two complementary (A pairs with T and G pairs with C) strands of double-stranded DNA have anti-parallel polarity. It means, if one strand is 5’to 3’, the other will be 3’to 5’. Thus, the complementary strand will be
5’- ATGCATGCATGCATGCATGCATGCATGC – 3’
3’- TACGTACGTACGTACGTACGTACG TACG -5’
Q.4 If the sequence of the coding strand in a transcription unit is written as follows:
5’-ATGCATGCATGCATGCATGCATGCATGC–3’.
Write down the sequence of mRNA.
Ans-
mRNA sequence:
5’- AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’
Explanation: The process of converting genetic information from one strand of the DNA into RNA is termed as transcription. It is the template strand is for mRNA synthesis. The coding strand in a transcription unit does not code for any mRNA but has a sequence similar to mRNA except that uracil replaces thymine.
Q.5 Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
Ans-
The specific base pair property of nucleotides (Adenosine pairing with Thymine and Cytosine pairing with Guanine) in DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. They proposed that the two strands of a DNA molecule separate during replication (the process of duplication of DNA). After separation, each strand acts as a template for the synthesis of the new strand, following the base-pairing rule. Thus, the new DNA double helix that is created has one parental strand and one new strand. This scheme is referred to as semi-conservative DNA replication.
Q.6 Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.
Ans-
The various types of nucleic acid polymerases involved in the following processes are:
a. Replication process (DNA to DNA): DNA-dependent DNA Polymerases
b. Transcription process (DNA to RNA): DNA-dependent RNA polymerase
Q.7 How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Ans-
Hershey and Chase grew some bacteriophages on a medium containing radioactive phosphorus and some others on medium containing sulphur. Viruses grown on the radioactive phosphorus contained radioactive DNA since phosphorus is part of DNA however, their protein was normal. On the other hand, viruses grown on the radioactive sulphur had radioactive protein, not the DNA since sulphur is the part of the protein.
Then, they went ahead with these radiolabelled bacteriophages (cultures in which either the protein capsule is labelled with radioactive sulphur or the DNA core is labelled with radioactive phosphorus) to infect E.coli host in two separate set of experiments followed by agitation in a blender to dislodge phage particles from bacterial cells and centrifugation to concentrate cells, separating them from the phage particles left in the supernatant.
Result: They checked for the presence of radioactivity in these two sets of experiments and the following observations were made:
a. Radioactivity was detected in bacteria, which were infected with viruses containing radioactive phosphorus and therefore, radioactive DNA. No radioactivity was detected in the supernatant which contained the protein head. New generation of radioactive and infective phages could be isolated from this culture. This suggested that radioactive DNA has entered the bacterial cell.
b. The other set of bacteria which were infected with bacteriophages labelled with radioactive sulphur had no radioactivity in them. Instead, the entire radioactive sulphur was detected in the supernatant. This indicated that protein did not enter the bacterial cell.
Therefore, this experiment clearly showed that it is the DNA, not protein that acts as genetic material and passes the information from one generation to the next.
Q.8 Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNA and tRNA
(c) Template strand and Coding strand
Ans-
(a) Repetitive DNA and Satellite DNA
| Repetitive DNA | Satellite DNA |
| Repetitive DNA is the sequence of DNA in the genome where a small stretch is repeated many times. The repetitive DNA code for proteins. | Satellite DNA does not code for any protein but forms a large portion of tandemly repeating DNA like centromeric region. |
(b) mRNA and tRNA
| mRNA | tRNA |
| 1. It is known as messenger RNA. | 1. It is known as transfer RNA. |
| 2. mRNA is the template, which helps to translate the genetic information coded by the DNA into proteins. | 2. tRNA carries amino acids to the ribosomes for protein synthesis. It acts as an adaptor molecule between mRNA and ribosomes for the synthesis of proteins. |
c. Template strand and Coding strand
| Template strand | Coding strand |
| In the double helix, the DNA strand that has the polarity 3’to 5’ and also acts as a template for coding the mRNA is referred to as a template strand. | The strand of the double helix with 5’ to 3’ polarity, which is displaced during transcription is called the coding strand. It has sequenced the same as that of mRNA (except thymine at the place of uracil). |
Q.9 List two essential roles of ribosome during translation.
Ans-
The translation is the process of making proteins using cellular machinery with the help of specialised units called ribosomes. During translation, the information carried by messenger RNA (mRNA) produced by transcription is translated into a polypeptide using the ribosome complex. The order and sequence of amino acids are defined by the sequence of bases in the mRNA. The amino acids are joined by a bond called peptide bond and this process requires energy. In the first phase of the process, the amino acids are activated in the presence of ATP and linked to their cognate tRNA, which acts as an adaptor molecule. When two such charged tRNAs come in close proximity, the formation of a peptide bond occurs between the two loaded amino acids. A catalyst is needed for this entire process. This is where the machinery of ribosomes comes into action in the following ways:
a. The ribosome consists of structural RNAs and about 80 different proteins. There are two subunits, which remain separate in its inactive state however when the smaller subunit encounters an mRNA, the process of translation begins. The larger subunit has two sites for the activated tRNAs to bind, thus bringing amino acids in close proximity for the formation of a peptide bond.
b. It also acts as a catalyst for the formation of the peptide bond.
Q.10 In the medium where E.coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Ans-
The lac operon consists of one regulatory gene (the i gene – the term i is derived from the word inhibitor) and three structural genes (z, y and a). The i gene codes for the repressor of the operon. The z gene codes for beta-galactosidase (β-gal), which is responsible for the hydrolysis of the sugar lactose into monomeric units, galactose and glucose. The y gene codes for permease, which increases cell permeability to β -galactosidases. The a gene encodes a transacetylase. Hence, all three genes of the operon are involved in lactose metabolism.
Lactose which is the substrate for the enzyme β –galactosidases, also acts as an inducer of the operon by switching on and off of the operon. When lactose is provided in the medium as a carbon source, it is transported into the cells by the action of a little amount of permease present in the cell. This lactose then induces the operon by inactivating the repressor. When lactose was absent, the repressor produced by the i gene remains bound to the operator region and prevents RNA polymerase from transcribing the operon. Once the repressor is inactivated in the presence of lactose, RNA polymerase initiates the transcription process.
However, after sometime, the lac operon shuts down because of catabolite repression of the lac operon. The level of lactose decreases and that of glucose rises. If lactose and glucose are present, the cell will use glucose before the lac operon is turned on. This type of control is termed catabolite repression. To prevent lactose metabolism, the second level of control of gene expression exists. The promoter of the lac operon has two binding sites. One site is where RNA polymerase binds. The second location is the binding site for a complex between the catabolite activator protein (CAP) and cyclic AMP (cAMP). The binding of the CAP-cAMP complex to the promoter site is required for transcription of the lac operon. The presence of this complex is closely associated with the presence of glucose in the cell. With the increase in the concentration of glucose, the amount of cAMP decreases. Thus, the amount of complex decreases. This decrease in the complex inactivates the promoter, and the lac operon is turned off. Because the CAP-cAMP complex is needed for transcription, the complex exerts positive control over the expression of the lac operon.
Q.11 Explain (in one or two lines) the function of the following:
(a) Promoter
(b) tRNA
(c) Exons
Ans-
(a) Promoter: A promoter is the part of DNA from where transcription of a particular gene is initiated and is usually located towards 5’-end of the structural gene on the coding strand, close of the gene it works for. It contains specific sequences and response elements that provide the binding site for RNA polymerase and other transcription factors that help in recruiting the RNA polymerase on the promoter.
(b) tRNA: tRNA is the adaptor molecule responsible for reading the genetic information on the mRNA and bringing in specific amino acid, thus translating the information on mRNA into a polypeptide. tRNA has an anticodon loop that has bases complementary to the code on mRNA and the other end, has an amino acid acceptor end to which amino acids bind.
(c) Exons: Exons are parts of DNA that are converted into mature messenger RNA (mRNA). These are the DNA sequences of a eukaryotic split gene that code for proteins. The exons are interrupted by introns.
Q.12 Why is the Human Genome project called a mega project?
Ans-
The quest to find differences between two individuals at a gross level due to differences at the DNA level lead to a very ambitious project in the 1990s. This mega project was called the Human Genome Project (HGP). The goal was to discover the genetic make-up of individuals to the DNA level. With the establishment of precise genetic engineering methods, it became possible to clone any sequence of DNA and availability of simple and fast DNA sequencing techniques made HGP a possibility.
The goals of the Human Genome Project were:
a. To identify all the genes in human DNA which were estimated to be around 20,000-25,000.
b. To determine the sequence of 3 billion base pairs which make up the entire human genome.
c. To store this massive information in properly catalogued databases.
d. To improve data analysis tools to analyse the generated data.
e. To address the ethical, legal and social issues arising out of the project.
The human genome is said to have approximately 3 X 109 base pairs. With the cost of sequencing each base way back in the 1990s to be around US $ 3 per base pair, the total estimated cost of the entire HGP was calculated to be around 9 billion US dollars. Further, it was calculated that around 3300 books (of 1000 pages with 1000 letters typed on each page) would be required to store the data generated by sequencing of a single human cell. This enormous data necessitated the need for high-speed computational devices for data storage, retrieval and analysis.
Human Genome Project took 13 long years to finish. It was coordinated by the U.S. Department of Energy and the National Institute of Health. During the early years of the HGP, the Wellcome Trust (U.K.) became a major partner with support coming to Japan, France, Germany, China and others. The project was completed in 2003.
These were the reasons to term Human Genome Project as a mega project.
Q.13 What is DNA fingerprinting? Mention its application.
Ans-
DNA fingerprinting is a quick way to compare the DNA sequences of any two individuals. 99.9% of base sequence among individuals is similar; it is only the remaining 0.1% which gives distinguishing characteristics to each individual. Now, if one needs to find out genetic differences between two individuals in a population, sequencing 3X109 bases every time would be a very time consuming and expensive affair. DNA fingerprinting is a way to identify differences in some specific regions in the DNA known as VNTR (Variable number of tandem repeats) repetitive DNA or more specifically, microsatellites, to make identification much easier. Microsatellites are short pieces of DNA which repeat many times in a given person’s DNA. By comparing a number of microsatellites in a given area, one can identify a person easily.
Applications of DNA fingerprinting:
1. In paternity issues since polymorphisms are inherited from parents to children.
2. In forensic crime analysis (using blood, hair-follicle, skin, saliva, semen, etc)
3. In population genetics to analyse variation within the population.
4. In conservation biology to study the genetic variability of endangered species.
5. In evolutionary biology to compare DNA extracted from fossils to present-day animals or humans.
Q.14 Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
(a) Transcription: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. The segment of DNA, which is transcribed during the process of transcription constitutes the transcription unit and is comprised of a promoter, the structural gene and a terminator. All three types of RNA, namely, mRNA, tRNA, and rRNA are synthesised using the process of transcription.
DNA-dependent RNA polymerase catalyses the reaction of transcription using the template strand which has 3’ to 5’polarity. It binds to the promoter and initiates the transcription process. This process follows the base complementarity rule except for that adenosine pairs up with uracil instead of thymine. This process is also called elongation. Once the polymerase reaches the terminator sequence, the RNA polymerase along with the nascent RNA falls off from the template. The process of falling fo nascent RNA is called termination.
RNA polymerase by itself is capable of the only elongation. It takes the help of the initiation factor and termination factor to initiate and terminate transcription. mRNA generated during the transcription process in bacteria doesn’t require further processing, thus, translation can begin at the same time. However, in eukaryotes, there are two additional complexities associated with transcription:
- Different kinds of RNA polymerases catalyse the formation of different kinds of RNAs.
- The primary transcript, which contains both exons and introns, and is non-functional, is subjected to the process of splicing, capping and tailing.
(b) Polymorphism: It is a form of genetic variation in which a DNA molecule consists of the distinct nucleotide sequence at a particular site. It is a heritable mutation and can be in a population at a high frequency. It can arise due to mutation in somatic or germ cells. The mutations in germ cells are transmitted from parents to offsprings. This causes accumulation of various mutations in a population leading to variation and polymorphism.
(c) Translation: The process of polymerisation of amino acids to form a polypeptide chain using the information defined by the sequence of bases in the mRNA is called translation. This is an energy-driven process. The amino acids are first activated in the presence of ATP and linked to their cognate t-RNA (aminoacylation of tRNA). When two such charged tRNAs come in close proximity to each other, the formation of the peptide bond is favoured. Also, a catalyst required for this bond formation enhances the reaction. These two processes are carried out by very specialised cellular machinery called ribosomes. The ribosome consists of structural RNAs and about 80 different proteins. There are two subunits, which remain separated in their inactive state however when the smaller subunit encounters an mRNA, the process of translation begins. The larger subunit has two sites for the activated tRNAs to bind to, thus bringing amino acids in close proximity for the formation of the peptide bond. The ribosome also acts as a catalyst for the formation of the peptide bond.
A translational unit in mRNA is the sequence of RNA that is flanked by the start codon (AUG) and the stop codon and codes for polypeptides. mRNA has some characteristic sequences called untranslated regions (UTRs) for the efficient translation process, but they are not translated.
For initiation, the ribosome binds to the mRNA at the start codon (AUG) followed by the elongation phase of protein synthesis. During this stage, charged tRNAs sequentially bind to the appropriate codon in mRNA by forming complementary base pairs with the tRNA anticodon. The ribosome moves from codon to codon along the mRNA adding amino acids one by one till it reaches the stop codon. Release factor binding to the stop codon results in termination and release of the complete polypeptide from the ribosome.
(d) Bioinformatics: The application of computer technology to manage biological information is called bioinformatics. This is a field that combines the knowledge of computer science, statistics, mathematics, and engineering to process biological data. Computers gather, store, analyse and then integrate the information which is then applied to various method developments in biological systems. A major activity in bioinformatics is to develop software tools to generate useful biological knowledge out of existing data.
The branch of bioinformatics came into existence with the progress of the Human Genome Project when a large amount of data became publicly available. The main aim of this project was to determine the sequence of the entire human genome (approximately three billion base pairs). This systematic approach of deciphering information using computers helped drastically in gene discovery programs across the world using biological information.
With the use of Next Generation sequencing technologies, where massive data is being generated across the world for many animals and plants, the meaning and usefulness of bioinformatics have become all the relevant.
Related Chapters
FAQs (Frequently Asked Questions)
The molecular basis of inheritance chapter in class 12 biology is an important chapter for students. In the board examinations, this chapter accounts for most of the marks. As a result, students must ensure that they analyse the whole chapter properly. This chapter covers the fundamentals of human genetics, such as DNA, RNA, replication, transcription, and translation.
Deoxyribonucleic acid, or DNA, is the genetic substance of humans and other creatures. Friedrich Meischer discovered DNA for the first time in 1869. James Watson and Francis Crick in 1953 discovered the double-helix structure of DNA. DNA is a continuous polymer made up of nucleotide units held together by sugar and phosphate groups.
