NCERT Solutions Class 12 Biology

NCERT Solutions for Class 12 Biology

At its core, biology is one of the most interesting subjects, but it can also be very challenging to understand at times.. Knowing about  human anatomy as well as those of plants and animals can be an eye-opening learning experience. However, Class 12 Biology is very advanced and may be difficult to understand for many.

This is why the CBSE Board itself has recommended the NCERT solutions for Class 12 Biology to help students strengthen their understanding of the subject. These solutions have been compiled by subject matter experts and each concept is explained thoroughly in easy-to-understand language. There are relevant examples given and there are quizzes and questions at the end to help students grasp the concepts well.

NCERT Biology Class 12 Solutions Download

Though many students love Biology as a subject, it covers various lengthy theoretical topics. Most of the students find difficulty memorising the essential terms and sometimes fail to understand several essential life processes. Chapters like Evolution, Genetics, Biotechnology, etc., cover various topics that can be difficult to comprehend for many students, so they tend to skip these chapters. With Extramarks, you get the assurance that with the help of our subject-matter experts, you will be able to understand any chapter of Class 12th Biology easily and will be able to score well in the examinations. The NCERT Solutions for Class 12 Biology provided on this page contain solutions that are prescribed for textbooks you use in the CBSE syllabus.

NCERT Class 12 Biology Chapter Wise Solutions – FREE Download

NCERT Biology Class 12

According to the CBSE board previous year question papers of 12th biology,  it is recommended that to learn Class 12th Biology, NCERT solutions should be your first priority. The 12th Biology NCERT book covers all the concepts in a concise manner. While going through the Class 12 Biology Chapters, you may face many difficulties in understanding several processes. The NCERT Solutions for Class 12 Biology available on Extramarks consist of easy explanations of all these concepts. So, download and refer to these NCERT Solutions for effective exam preparation.

Class 12 Biology NCERT Solutions

After going through the chapters of the Biology 12th NCERT book, students must complete the exercises given at the end of every chapter. Some questions are very tricky, and many of you may need some help answering them. So, Extramarks brings you the NCERT Class 12 Biology Solutions wherein you get precise answers to all the exercise questions of Class 12 Biology. These NCERT Solutions for Biology Class 12 can be downloaded from Extramarks for free of cost.

Solutions for Chapters of Biology 12th NCERT, Chapter Wise FREE Download

If you follow the right learning technique, studying biology can be the most comfortable and enjoyable experience for you. At Extramarks, we follow the most effective study techniques to make your learning experience easier. So, there are several chapters in class 12th Biology, and you can access and download the chapter-wise NCERT Solutions for Biology Class 12 for every chapter from Extramarks. The chapters covered in NCERT Solutions are as follows –

Chapter 1: Reproduction in Organisms

The Reproduction in Organisms chapter involves the procreation process of different organisms. Reproduction is a biological process that results in organisms giving birth to their young ones. This process can be categorised into two types. The first one is asexual reproduction in which the offspring is procreated only by a single parent or without the gamete formation. The second one is sexual reproduction in which two parents of opposite sex procreate through the fusion of female and male gametes. The chapter will explain these concepts in detail through examples and diagrams.

Chapter 2: Sexual Reproduction in Flowering Plants

This chapter focuses on the sexual reproduction in flowering plants along with the structure, morphology, and processes. It further elaborates on concepts like pre-fertilisation: Structure and Events, Port fertilisation: Structure and Events, Double fertilisation, Polyembryony, and Apomixis.

Chapter 3: Human Reproduction

In the Human Reproduction chapter, the reproductive events in humans are discussed. This includes gametogenesis (the formation of gametes). Humans become sexually mature after reaching puberty. The reproductive events related to males and females are different. You will be able to examine these differences in this chapter. The sub-topics discussed in this chapter include the female reproductive system, the male reproductive system, fertilisation and implantation, menstrual cycle, gametogenesis, embryonic development and pregnancy, lactation, and parturition.

Chapter 4: Reproductive Health

The previous chapters covered the human reproductive system as well as its functions. In this chapter, a closely related topic is discussed – Reproductive Health. Reproductive health refers to the healthy reproductive organs and their normal functions. The World Health Organisation (WHO) defines reproductive health as the total well-being in every aspect of reproduction which includes physical, behavioural, social, and emotional. This chapter will cover subtopics like Reproductive Health – Problems and Strategies, Birth Control, Population Explosion, Medical Termination of Pregnancy, Infertility, Sexually Transmitted Diseases, etc.

Chapter 5: Principles of Inheritance and Variation

Genetics is one of the many branches of Biology. It deals with inheritance and the variance of characters in offspring from their parents. The inheritance process involves the characters passed on from the parents to their progeny. In this chapter, concepts like Mendel’s different Laws of Inheritance, Sex Determination, Inheritance of One Gene or Two Genes, Genetic Disorders, and Mutation are discussed in detail. 

Chapter 6: Molecular Basis of Inheritance

The previous chapters have covered the inheritance patterns as well as the genetic basis of these patterns. During the time of Mendel, the factors that regulated the inheritance pattern were unclear. However, over the next century, the investigation of the nature of putative genetic material saw great strides. It led to the realisation that Deoxyribonucleic Acid (DNA) is the genetic material for most organisms. Class XI syllabus covered that nucleic acids were polymers of nucleotides. This chapter will cover concepts like the DNA, RNA World, Search for Genetic Material, Genetic Code, Transcription, Replication, Translation, Human Genome Project, DNA Fingerprinting, and Regulation of Gene Expression.

Chapter 7: Evolution

Evolutionary Biology is the field that studies the history of life on Earth. The Evolution Chapter covers subtopics like Origin of Life, Evolution – A Theory, Evidence for Evolution, Adaptive Radiation, Mechanisms of Evolution, Biological Evolution, Hardy Weinberg principle, Origin and Evolution of Man, etc.

Chapter 8: Human Health and Diseases

Health can be affected by:

Genetic Disorders – Conditions that a child is born with, as well as defects or deficiencies inherited from their parents.Infections.

Lifestyle – Habits that we have, water and food that we consume, exercise and rest that we take.

This chapter will explore topics like Common Diseases in Humans, Drugs, Cancer, AIDS, Alcohol Abuse, and Immunity.

Chapter 9: Strategies for Enhancement in Food Production

Due to population growth, there is an increased need to enhance the processes of food production. Biological principles that are applied to plant breeding and animal husbandry play an important role in improving the food production process. There are several techniques like tissue culture techniques and embryo transfer technology that can enhance this process even more. The Strategies for Enhancement in Food Production chapter will cover concepts including Tissue Culture, Animal Husbandry, Single Cell Proteins, and Plant Breeding.

 Chapter 10: Microbes in Human Welfare

Apart from macroscopic animals and plants, biological systems have another major component known as microbes. In previous classes, students learned about living organisms and their diversity. Microbes are a diverse group that includes bacteria, protozoa, fungi, and microscopic plant and animal viruses. Microbes, like many fungi and bacteria, can grow on nutritive media and form colonies that are visible to the naked eye. These cultures are very useful when studying microorganisms. In this chapter, topics like Microbes in Industrial Products, Microbes in Household Products, Microbes in Biogas Production, Microbes in Sewage Treatment, Microbes as Biofertilisers, and Microbes Biocontrol Agents are explained thoroughly.

Chapter 11: Biotechnology Principles and Processes

Biotechnology is a field that deals with the process of using enzymes from organisms or live organisms to produce processes and products that are useful to humans. According to the definition provided by the European Federation of Biotechnology (EFB), biotechnology encompasses traditional views as well as modern molecular biotechnology. It is the integration of organisms, cells, and molecular analogues with natural science to provide services and products.. This chapter will cover concepts like Principles of Biotechnology, Recombinant DNA Technology tools and processes, etc. 

Chapter 12: Biotechnology: and Its Application

In the previous chapters, there were concepts covering the industrial-scale production of biologicals and biopharmaceuticals using genetically modified animals, plants, fungi, and microbes. This chapter covers the applications of biotechnology, including diagnostics, therapeutics, genetically modified crops used for agriculture, waste treatment, energy production, bioremediation, and processed food. It also includes concepts like Biotechnical Applications in Medicine and Agriculture, Transgenic Animals, Ethical Issues, etc.

Chapter 13: Organisms and Populations

The previous chapters have covered how ecology involves studying organisms’ interactions with one another, other organisms, and the physical environment.This chapter involves discussions on biological organisation’s four levels – organisms, populations, biomes, and communities. The Ecology at the population and organismic levels are explained in detail. It also includes concepts like Organisms and their Environment and Populations.

Chapter 14: Ecosystem

An Ecosystem can be considered  nature’s functional unit where organisms live and interact with each other and with the surrounding physical environment. The Ecosystem chapter will begin by discussing the ecosystem structure. This will help in understanding the input, transfer of energy, and output. Next come the relationships that are created because of the energy flows in the system and the inter-relationships, including webs, chains, and cycles. The chapter covers subtopics like Structure and Function of Ecosystem, Decomposition, Productivity, Energy Flow, Ecological Succession, Ecological Pyramids, Ecosystem Services, and Nutrient Cycling.

Chapter 15: Biodiversity and Conservation

The Biodiversity and Conservation chapter covers topics like Species diversity, Genetic diversity, Ecological Diversity, Patterns of Diversity, Loss of Biodiversity, Different types of Species, Biodiversity Conservation, etc. The conservation of Biodiversity might be in situ or ex-situ. In the case of in-situ conservation, the species that are endangered receive protection in their natural habitat in order to ensure the protection of the entire ecosystem. In ex-situ conservation,  threatened species are protected in botanical gardens and zoological parks through cryopreservation of gametes, tissue culture propagation, and in vitro fertilisation.

Chapter 16: Environmental Issues

Over the last hundred years, the size of the human population has increased exponentially. This has put pressure on natural resources. With the increased demand for water, food, home, roads, electricity, automobiles, and other commodities, there have been some undesirable changes. One such change is Pollution. Pollution is a negative change in the physical, biological, or chemical characteristics of air, water, soil, or land. The agents causing this undesirable change are known as pollutants. This chapter will cover subtopics like Air Pollution, Water Pollution, Radioactive Wastes, Solid Wastes, Greenhouse Effect, Global Warming, Agrochemicals and their effects, Ozone Depletion in the Stratosphere, Deforestation, and Degradation caused by Improper Utilisation and Maintenance of Resources.

Benefits of Studying from NCERT Solutions Class 12 Biology

  •       These NCERT solutions for Class 12 Biology are prepared in accordance with the latest CBSE guidelines.
  •         Every answer in these NCERT Solutions is written in a precise manner.
  •         The short-answer questions will enable you to memorise the concepts quickly.
  •         These solutions are provided and verified by our experienced experts.
  •         The answers are given in-depth and cover all the essential concepts.

·         All the Solutions can be downloaded for free from Extramarks.

Q.1 If a population growing exponentially double in size in 3 years, what is the intrinsic rate of increase (r) of the population?

Ans.

The exponential growth of a population can be calculated by the following exponential growth equation: N t = N o e rt Where, N t = Population density after time t N o = Population density at time 0 r = Intrinsic rate of population change e = Base of natural logarithms 2.71828 Let the present day population density be x. Thus, population density after 2 years = 2x t = 3 years The intrinsic rate of increase r of a population can be calculated by substituting the respective values in the above equation. 2x = xe 3 r 2 = e 3 r Applying log on both sides, we get Log 2 = 3r log e log2 3loge = r 0.301 3×0.434 = r 0.301 1.302 = r 0.2311 = r Thus, the intrinsic rate of increase for the given population is 0.2311. MathType@MTEF@5@5@+= feaahqart1ev3aaatCvAUfeBSjuyZL2yd9gzLbvyNv2CaerbuLwBLn hiov2DGi1BTfMBaeXatLxBI9gBaerbd9wDYLwzYbItLDharqqtubsr 4rNCHbGeaGqiVu0Je9sqqrpepC0xbbL8F4rqqrFfpeea0xe9Lq=Jc9 vqaqpepm0xbba9pwe9Q8fs0=yqaqpepae9pg0FirpepeKkFr0xfr=x fr=xb9adbaqaaeGaciGaaiaabeqaamaabaabaaGceaqabeaaqaaaaa aaaaWdbiaabsfacaqGObGaaeyzaiaabccacaqGLbGaaeiEaiaabcha caqGVbGaaeOBaiaabwgacaqGUbGaaeiDaiaabMgacaqGHbGaaeiBai aabccacaqGNbGaaeOCaiaab+gacaqG3bGaaeiDaiaabIgacaqGGaGa ae4BaiaabAgacaqGGaGaaeyyaiaabccacaqGWbGaae4Baiaabchaca qG1bGaaeiBaiaabggacaqG0bGaaeyAaiaab+gacaqGUbGaaeiiaiaa bogacaqGHbGaaeOBaiaabccacaqGIbGaaeyzaiaabccacaqGJbGaae yyaiaabYgacaqGJbGaaeyDaiaabYgacaqGHbGaaeiDaiaabwgacaqG KbGaaeiiaiaabkgacaqG5bGaaeiiaiaabshacaqGObGaaeyzaiaabc caaeaacaqGMbGaae4BaiaabYgacaqGSbGaae4BaiaabEhacaqGPbGa aeOBaiaabEgacaqGGaGaaeyzaiaabIhacaqGWbGaae4Baiaab6gaca qGLbGaaeOBaiaabshacaqGPbGaaeyyaiaabYgacaqGGaGaae4zaiaa bkhacaqGVbGaae4DaiaabshacaqGObGaaeiiaiaabwgacaqGXbGaae yDaiaabggacaqG0bGaaeyAaiaab+gacaqGUbGaaeOoaaqaa8aafaqa aeGbbaaaaeaapeGaaeOta8aadaWgaaWcbaWdbiaabshaa8aabeaak8 qacaqG9aGaaeiiaiaab6eapaWaaSbaaSqaa8qacaqGVbaapaqabaGc peGaaeyza8aadaahaaWcbeqaa8qacaqGYbGaaeiDaaaaaOWdaeaape Gaae4vaiaabIgacaqGLbGaaeOCaiaabwgacaqGSaaapaqaa8qacaqG obWdamaaBaaaleaapeGaaeiDaaWdaeqaaOWdbiaab2dacaqGGaGaae iuaiaab+gacaqGWbGaaeyDaiaabYgacaqGHbGaaeiDaiaabMgacaqG VbGaaeOBaiaabccacaqGKbGaaeyzaiaab6gacaqGZbGaaeyAaiaabs hacaqG5bGaaeiiaiaabggacaqGMbGaaeiDaiaabwgacaqGYbGaaeii aiaabshacaqGPbGaaeyBaiaabwgacaqGGaGaaeiDaaWdaeaapeGaae Ota8aadaWgaaWcbaWdbiaab+gaa8aabeaak8qacaqG9aGaaeiiaiaa bcfacaqGVbGaaeiCaiaabwhacaqGSbGaaeyyaiaabshacaqGPbGaae 4Baiaab6gacaqGGaGaaeizaiaabwgacaqGUbGaae4CaiaabMgacaqG 0bGaaeyEaiaabccacaqGHbGaaeiDaiaabccacaqG0bGaaeyAaiaab2 gacaqGLbGaaeiiaiaabcdaa8aabaWdbiaabkhacaqGGaGaaeypaiaa bccacaqGjbGaaeOBaiaabshacaqGYbGaaeyAaiaab6gacaqGZbGaae yAaiaabogacaqGGaGaaeOCaiaabggacaqG0bGaaeyzaiaabccacaqG VbGaaeOzaiaabccacaqGWbGaae4BaiaabchacaqG1bGaaeiBaiaabg gacaqG0bGaaeyAaiaab+gacaqGUbGaaeiiaiaabogacaqGObGaaeyy aiaab6gacaqGNbGaaeyzaaWdaeaapeGaaeyzaiaabccacaqG9aGaae iiaiaabkeacaqGHbGaae4CaiaabwgacaqGGaGaae4BaiaabAgacaqG GaGaaeOBaiaabggacaqG0bGaaeyDaiaabkhacaqGHbGaaeiBaiaabc cacaqGSbGaae4BaiaabEgacaqGHbGaaeOCaiaabMgacaqG0bGaaeiA aiaab2gacaqGZbGaaeiia8aadaqadaqaa8qacaqGYaGaaeOlaiaabE dacaqGXaGaaeioaiaabkdacaqG4aaapaGaayjkaiaawMcaaaaaaeaa faqaaeWabaaabaWdbiaabYeacaqGLbGaaeiDaiaabccacaqG0bGaae iAaiaabwgacaqGGaGaaeiCaiaabkhacaqGLbGaae4CaiaabwgacaqG UbGaaeiDaiaabccacaqGKbGaaeyyaiaabMhacaqGGaGaaeiCaiaab+ gacaqGWbGaaeyDaiaabYgacaqGHbGaaeiDaiaabMgacaqGVbGaaeOB aiaabccacaqGKbGaaeyzaiaab6gacaqGZbGaaeyAaiaabshacaqG5b GaaeiiaiaabkgacaqGLbGaaeiiaiaabIhacaqGUaaapaqaa8qacaqG ubGaaeiAaiaabwhacaqGZbGaaeilaiaabccacaqGWbGaae4Baiaabc hacaqG1bGaaeiBaiaabggacaqG0bGaaeyAaiaab+gacaqGUbGaaeii aiaabsgacaqGLbGaaeOBaiaabohacaqGPbGaaeiDaiaabMhacaqGGa GaaeyyaiaabAgacaqG0bGaaeyzaiaabkhacaqGGaGaaeOmaiaabcca caqG5bGaaeyzaiaabggacaqGYbGaae4CaiaabccacaqG9aGaaeiiai aabkdacaqG4baapaqaa8qacaqG0bGaaeiiaiaab2dacaqGGaGaae4m aiaabccacaqG5bGaaeyzaiaabggacaqGYbGaae4Caaaaa8aabaWdbi aabsfacaqGObGaaeyzaiaabccacaqGPbGaaeOBaiaabshacaqGYbGa aeyAaiaab6gacaqGZbGaaeyAaiaabogacaqGGaGaaeOCaiaabggaca qG0bGaaeyzaiaabccacaqGVbGaaeOzaiaabccacaqGPbGaaeOBaiaa bogacaqGYbGaaeyzaiaabggacaqGZbGaaeyzaiaabccapaWaaeWaae aapeGaaeOCaaWdaiaawIcacaGLPaaapeGaaeiiaiaab+gacaqGMbGa aeiiaiaabggacaqGGaGaaeiCaiaab+gacaqGWbGaaeyDaiaabYgaca qGHbGaaeiDaiaabMgacaqGVbGaaeOBaiaabccacaqGJbGaaeyyaiaa b6gacaqGGaGaaeOyaiaabwgacaqGGaGaae4yaiaabggacaqGSbGaae 4yaiaabwhacaqGSbGaaeyyaiaabshacaqGLbGaaeizaiaabccaaeaa caqGIbGaaeyEaiaabccacaqGZbGaaeyDaiaabkgacaqGZbGaaeiDai aabMgacaqG0bGaaeyDaiaabshacaqGPbGaaeOBaiaabEgacaqGGaGa aeiDaiaabIgacaqGLbGaaeiiaiaabkhacaqGLbGaae4Caiaabchaca qGLbGaae4yaiaabshacaqGPbGaaeODaiaabwgacaqGGaGaaeODaiaa bggacaqGSbGaaeyDaiaabwgacaqGZbGaaeiiaiaabMgacaqGUbGaae iiaiaabshacaqGObGaaeyzaiaabccacaqGHbGaaeOyaiaab+gacaqG 2bGaaeyzaiaabccacaqGLbGaaeyCaiaabwhacaqGHbGaaeiDaiaabM gacaqGVbGaaeOBaiaab6caaeaacqGH0icxcaqGGaGaaeOmaiaabIha caqG9aGaaeiEaiaabwgapaWaaWbaaSqabeaapeGaae4maaaakiaabk haaeaacqGH0icxcaaMc8UaaGPaVlaaykW7caqGYaGaaeypaiaabwga paWaaWbaaSqabeaapeGaae4maaaakiaabkhaaeaacaqGbbGaaeiCai aabchacaqGSbGaaeyEaiaabMgacaqGUbGaae4zaiaabccacaqGSbGa ae4BaiaabEgacaqGGaGaae4Baiaab6gacaqGGaGaaeOyaiaab+gaca qG0bGaaeiAaiaabccacaqGZbGaaeyAaiaabsgacaqGLbGaae4Caiaa bYcacaqGGaGaae4DaiaabwgacaqGGaGaae4zaiaabwgacaqG0baaba GaeyO0H4TaaeiiaiaabYeacaqGVbGaae4zaiaabccacaqGYaGaaeii aiaab2dacaqGGaGaae4maiaabkhacaqGGaGaaeiBaiaab+gacaqGNb GaaeiiaiaabwgaaeaacqGHshI3daWcaaWdaeaapeGaaeiBaiaab+ga caqGNbGaaeOmaaWdaeaapeGaae4maiaabYgacaqGVbGaae4zaiaabw gacaqGGcaaaiaab2dacaqGYbaabaGaeyO0H4TaaeiOamaalaaapaqa a8qacaqGWaGaaeOlaiaabodacaqGWaGaaeymaaWdaeaapeGaae4mai aabEnacaqGWaGaaeOlaiaabsdacaqGZaGaaeinaaaacaqG9aGaaeOC aaqaaiabgkDiEpaalaaapaqaa8qacaqGWaGaaeOlaiaabodacaqGWa GaaeymaaWdaeaapeGaaeymaiaab6cacaqGZaGaaeimaiaabkdaaaGa aeypaiaabkhaaeaacqGHshI3caaMc8UaaGPaVlaabcdacaqGUaGaae OmaiaabodacaqGXaGaaeymaiaabccacaqG9aGaaeiiaiaabkhaaeaa caqGubGaaeiAaiaabwhacaqGZbGaaeilaiaabccacaqG0bGaaeiAai aabwgacaqGGaGaaeyAaiaab6gacaqG0bGaaeOCaiaabMgacaqGUbGa ae4CaiaabMgacaqGJbGaaeiiaiaabkhacaqGHbGaaeiDaiaabwgaca qGGaGaae4BaiaabAgacaqGGaGaaeyAaiaab6gacaqGJbGaaeOCaiaa bwgacaqGHbGaae4CaiaabwgacaqGGaGaaeOzaiaab+gacaqGYbGaae iiaiaabshacaqGObGaaeyzaiaabccacaqGNbGaaeyAaiaabAhacaqG LbGaaeOBaiaabccacaqGWbGaae4BaiaabchacaqG1bGaaeiBaiaabg gacaqG0bGaaeyAaiaab+gacaqGUbGaaeiiaiaabMgacaqGZbGaaeii aiaabcdacaqGUaGaaeOmaiaabodacaqGXaGaaeymaiaab6caaaaa@9873@

Q.2 Practise drawing various animals and plants.

Ans.

Select a few plants and animals that you find comparatively easy to draw and label. Practice on these diagrams to make them neat, clear and precise. You can also use the internet to find the name of different parts of their body. The labelled diagrams of goat and banana tree are given below for your reference.

Goat:

Banana tree:

Q.3 Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.

Ans.

Q.4 Name any five hybrid varieties of crop plants which have been developed in India.

Ans.

S.No. Hybrid Name Plant type Hybrid attribute
1 Sonalika and

Kalyan Sona

Wheat High yielding and disease resistant variety
2 Jaya and Ratna Rice High yielding and semi-dwarf variety
3 Pusa Komal Cowpea Bacterial blight
4 Pusa Swarnim Brassica White rust
5 Pusa Shubhra and

Pusa Snowball K-1

Cauliflower Black rot and curl

Blight black rot

Q.5 Find out what the various components of the medium used for propagation of an explant in vitro are?

Ans.

The plant tissue culture medium is an artificial nutrient supplement of organic and inorganic nutrients used for cultivation of an explant. The culture media used for the in vitro cultivation of the plant cells are composed of the following basic components:

  1. Essential elements supplied as a complex mixture of salts
  2. Organic supplements providing vitamins and amino acids
  3. A source of carbon which is usually supplied as sucrose
  4. Hormones such as auxins and gibberellins
  5. A gelling agent such as agar

Q.6 What is the major advantage of producing plants by micropropagation?

Ans.

Micropropagation is the practice of rapidly multiplying stock plant material to produce a large number of progeny plants, using modern plant tissue culture methods. Each of these plants will be genetically identical to the original plant from which they were grown, i.e., they are somaclones. Many important food plants like tomato, banana, apple, etc., have been produced on a commercial scale using this method.

Advantages of micropropagation:

  1. Allows propagation of a large number of plants that are clones of each other. This is especially useful when we want to retain a trait which may otherwise get segregated during meiosis in a plant.
  2. Micropropagation can produce disease-free plants as they are grown in controlled environments. This method can help recover healthy plants from diseased plants. This can be done by excising disease-free areas like the meristem from the infected plant which can be micropropagated in vitro.
  3. Allows propagation of plants that do not produce seeds or have only very few seeds, or cannot reproduce vegetatively, or have seeds that cannot be stored.

Q.7 Which part of the plant is best suited for making virus-free plants and why?

Ans.

The plant meristems are generally virus-free or carry a very low concentration of the virus. The reasons attributed to the absence of virus from the meristems are as follows:

  1. Absence of vascular system (through which the viruses travel) from the meristem.
  2. High auxin content in the shoot tip may prevent the growth of the virus.
  3. High metabolic activity of the rapidly dividing apical cells prevents the propagation of the virus.

Hence, one can remove the meristem and grow it in vitro to obtain virus-free plants. Scientists have succeeded in culturing meristems of banana, sugarcane, potato, etc.

The cells of the shoot and root apical meristems (SAM and RAM) divide rapidly and are considered to be indeterminate, in that they do not possess any defined end fate. The meristematic cells are frequently compared to the stem cells in animals, which have analogous behaviour and function. Under appropriate conditions, each shoot meristem can develop into a completely new plant or clone.

Q.8 Explain what is meant by biofortification.

Ans.

Biofortification is enhancement of nutritional value of a crop by selective breeding or genetic engineering. It involves breeding crops with higher levels of vitamins, mineral, protein or fat content. Biofortification is seen as a technique to provide nutritious food to the poor in the developing countries who do not have access or the means to eat a variety of healthy or fortified food.

Example: Golden rice is a variety of Oryza sativa rice produced through genetic engineering to biosynthesise beta-carotene, a precursor of vitamin A, in the edible parts of rice. The research was conducted with the goal of producing a fortified food to be grown and consumed in areas with a shortage of dietary vitamin A, the deficiency of which is estimated to kill hundreds of thousand children under the age of 5 every year. But being a genetically modified crop plant, the golden rice has faced a lot of opposition from the environmental groups and has not yet been commercialised on a planned scale.

Q.9 Briefly describe various steps involved in plant breeding.

Ans.

Plant breeding is a process that involves crossing or hybridization of pure lines followed by artificial selection to produce plants with desirable traits of higher yield, nutritive value and resistance to diseases. Green revolution in India came about so that, low yielding crop varieties could be replaced with varieties having desired traits such as high yield, disease resistance, drought resistance which lead to increased per hectare yields.

Classical plant breeding involves:

Collection of variability: The first step to a plant breeding program involves the collection of the genetic varieties available for that plant, which could be the wild type, existing hybrid varieties, and relatives of that plant. The entire collection (of plants/seeds) having all the diverse alleles for all the genes in a given crop is called germplasm collection.

Evaluation and selection of parents: The parents with the desired characters are selected for breeding. The parents are self crossed to get purebred lines, if possible, and are evaluated for the desired character before hybridization.

Cross hybridisation among the selected parents: The selected parents are cross-hybridised by the pollinating stigma of one parent with the pollen of the other, which is a tedious process.

Selection and testing of superior recombinants: Out of the numerous progeny from the cross, the plant that has both the desired characters of the parents is selected. This requires careful assessment and evaluation of the traits.

Inbreeding: The selected recombinants are put through a series of back crosses to yield purebred homozygous line. This confirms that the traits are inherited together, are stable and do not segregate.

Testing, release and commercialisation of new cultivars: The selected hybrids are tested for yields and other agronomic traits such as disease resistance. They are first evaluated by growing in research fields, then in certain designated farmer fields, in different regions of the country, along with the best cultivar of that region for reference. After a careful evaluation, the cultivar is released for commercialisation.

While the above method for plant breeding is an age-old method which has been practiced by our ancestors, today genetic engineering and molecular biology techniques are being used for creating different varieties of plants in a more targeted way. Genetically modified plants (GM plants) of different species are under cultivation today although some countries including India have been very conservative about GM plants. BT-brinjal is the only GM plant which has been approved for cultivation in India and has seen a slew of controversy in the past years.

Q.10 Discuss the role of fishery in enhancement of food production.

Ans.

Fishery is an industry devoted to the catching, processing or selling of fish, shellfish or other aquatic animals. A large number of our population is dependent on fish, fish products and other aquatic animals such as prawn, crab, lobster, edible oyster, etc., for food. Fish and other aquatic animals make for nutritious and high protein content food.

Blue revolution is being implemented in India which has helped to increase fish production by 10 fold in India since independence in 1947. This has happened because of different techniques like pisciculture (the breeding, rearing, and transplantation of fish by artificial means) and aquaculture (farming of aquatic organisms such as fish, crustaceans, molluscs and aquatic plants) which have helped to increase the production of aquatic animals and plants, both fresh-water and marine.

Q.11 What is apiculture? How is it important in our lives?

Ans.

Apiculture or bee-keeping is the maintenance of hives of honeybees for the production of honey. The first records of bee keeping go back upto 15,000 years. Today, this cottage industry has been adapted for high yield, easy harvest of honey and methods that do not involve the killing of huge number of bees as is done traditionally. Honey has many uses ranging from being used as a nutritive food, in the food industry to being used as a medicine. Bee-keeping is also a source of natural substances other than honey such as bees wax (used in cosmetics), propolis (traditional medicine) and royal jelly (traditional medicine, cosmetics, and dietary supplements). Apiculture also serves as a source for earning livelihood and can be carried out at low setup and low labour costs too.

Q.12 Name the methods employed in animal breeding. According to you, which of the methods is best? Why?

Ans.

Animal breeding is a technique whereby two closely related animals are mated to yield progeny having desirable characters of both the parents. Methods of animal breeding are:

Natural breeding: It includes the following:

  1. Inbreeding – Mating of more closely related individuals within the same breed for 4-6 generations.
  2. Outbreeding – It is breeding between unrelated animals. This is of the following types:

Cross-breeding: In this method, superior males of one breed are mated with superior females of another breed. Cross-breeding allows the desirable qualities of two different breeds to be combined.

Interspecific breeding: In this method, male and female animals of two different species are mated. In some cases, the progeny may combine desirable features of both the parents and may be of considerable economic value, e.g., the mule which is a cross between a donkey and a horse.

Out-crossing: This is the practice of mating of animals within the same breed, but having no common ancestors on either side of their pedigree up to 4-6 generations.

Artificial/ controlled breeding employs the following techniques:

  1. Multiple Ovulation Embryo Transfer Technology (MOET): In this method, a cow is administered hormones, with FSH-like activity, to induce follicular maturation and superovulation so that instead of one egg, which they normally yield per cycle they produce 6-8 eggs.
  2. Artificial insemination –The superovulated cows are artificially inseminated with the sperms of a male having desired traits. The embryos at an 8-32 day stage are removed from the genetic mother and transferred into surrogate mothers (that may be of lower quality). In this way, more progeny of the desired cross can be produced. Also, the genetic mother can be put through another cycle of superovulation.
  3. Sex determination – The sex of the embryos can be determined in utero at about 50 days of gestation. The normal gestation for Holstein-Friesian cattle is about 280 days, so this early determination of sex saves many days and allows the breeding program to be adjusted.

The controlled breeding methodology is much more accurate in terms of the desired crosses and the number of progeny of the desired parents that can be produced in one gestation period.

Q.13 What is meant by the term ‘breed’? What are the objectives of animal breeding?

Ans.

A group of animals related by descent and similar in most characters like general appearance, features, size, configuration, etc. are said to belong to a breed. The objectives of breeding are as follows:

  1. Selecting animals with a higher and superior yield of produce (like egg, meat, milk, or wool).
  2. To increase the resistance of the livestock to diseases, epidemics and making them suitable to local environmental conditions (e.g. availability of less water).

Some examples of breeds of cows are:

  • Ongole breed is indigenous to India, produces 3-12 litres of milk every day during lactation period. The fat content in the milk is over 5%.
  • Holstein breed of cow produces 24-28 litres of milk per day.

Q.14 If your family owned a dairy farm, what measures would you undertake to improve the quality and quantity of milk production?

Ans.

Milk production, in terms of both quality and quantity, depends on various aspects ranging from the breed of the animal to their keeping and handling.

Following measures can be undertaken to improve the quality and quantity of milk production:

  1. Good breed of the animal: A good breed will have greater milk yielding potential and resistance to diseases.
  2. Providing suitable environmental condition: Adequate ventilation, suitable temperature, sufficient light, water, air and well-drained hygienic housing accommodation should be provided.
  3. Food or fodder should be balanced, nutritious and adequate in terms of quantity.
  4. Stringent cleanliness and hygiene of both the animal and the caretaker are essential while milking and storage of milk.
  5. If any processes are mechanised, they should undergo regular inspection and quality control.
  6. Vaccination and regular health checks by a veterinary doctor are mandatory.

Q.15 Explain in brief the role of animal husbandry in human welfare.

Ans.

Animal husbandry involves breeding and taking care of domestic animals by using scientific principles. Animal husbandry deals with the care and breeding of livestock that is useful to humans like buffaloes, cows, pigs, horses, cattle, sheep, camels, goats, etc. It also includes poultry farming and fisheries.

Animal husbandry plays a useful role in human welfare by providing us with improved quality of milk, meat, eggs, wool, silk, honey and many other useful products having economic value. Also, rearing of animals generates employment for many.

Q.16 What is apomixis and what is its importance?

Ans.

The method devised by flowering plants to produce seeds without fertilisation is called apomixis. There are numerous ways by which apomixis happens:

  1. A diploid egg cell is formed without reduction division and develops into an embryo without fertilisation.
  2. The nuclear cells surrounding the embryo sac start dividing, protruding into the embryo sac and developing into the embryos; for example, Citrus and Mango.

Importance of apomixis:

Large varieties of food crops under cultivation are hybrid varieties and maintaining the hybrid characteristics in these plants is very difficult as they segregate in subsequent divisions. This is a costly process. If these hybrids are converted into apomicts (plants that carry out apomixes), there will be no segregation of characteristics as there will be no reduction division. This will allow the hybrid character to remain as it is and farmers need not buy seeds every year as they can raise hybrid seeds by themselves without losing the character.

Q.17 Explain the role of tapetum in the formation of pollen-grain wall.

Ans.

Tapetum is the innermost layer that surrounds the pollen grains inside the anther. The lobes of anther of a male flower develop to form pollen sacs. They extend longitudinally all through the length of an anther and are packed with pollen grains. This is surrounded by four layers namely epidermis, endothecium, middle layers and the tapetum. The three outer layers are protective whereas the tapetum, which constitutes the innermost layer, nourishes the pollen grains. The cells in this layer are large with densely packed cytoplasm and generally have more than one nuclei. This layer surrounds the sporogenous tissue occupying the centre of microsporangia. Tapetum helps in pollen wall formation, transportation of nutrients to the inner side of anther and is involved in the synthesis of callase enzyme for the separation of microspore tetrads.

Q.18 If one can induce parthenocarpy through the application of growth substances, which fruits would you select to induce parthenocarpy and why?

Ans.

If one can induce parthenocarpy through the application of growth substances, the fruits which contain a large number of hard seeds would be selected to induce parthenocarpy. Such fruits resemble a normally developed fruit but are seedless. Seedlessness is a desirable trait in edible fruit with hard seeds. This trait increases the commercial value as consumers prefer to eat fruits without seeds. Thus, varieties of pineapple, banana, cucumber, grape, orange, grapefruit, etc. can be selected to induce parthenocarpy. Parthenocarpy is also desirable in fruit crops that may be difficult to pollinate or fertilize, such as tomato.

Q.19 What is meant by emasculation? When and why does a plant breeder employ this technique?

Ans.

Emasculation is the removal of stamens from bisexual flowers of the female parents to avoid self-pollination in these flowers. It is done before the anthers mature. This is a very useful technique and has been widely utilized in plant breeding programme.

Plant breeders employ this technique for crop improvement programmes where they wish to select parent plants with desired traits or combine desirable characters to produce commercially ‘better’ varieties. They make sure that pollen grains with desired traits are used for pollination and the stigma is protected from contamination by other pollens. Emasculation is done in cases where the plant produces bisexual flowers.

The female reproductive part of the flower is covered with a bag of suitable size, usually made of butter paper. This prevents contamination of its stigma with unwanted pollen. Anthers are removed from the flower using a pair of forceps before covering the flower with bags. Once the stigma of the bagged flower attains maturity, mature pollen grains collected from anthers of the desired male parent are artificially dusted onto the stigma and the flowers are rebagged. Fruits are allowed to develop. This allows the development of the desired traits.

Q.20 Why is apple called a false fruit? Which part(s) of the flower forms the fruit?

Ans.

An apple is called a false fruit because the thalamus (an accessory part) along with ovary contributes to the fruit formation. It develops from a compound ovary but much of the fruit’s edible part comes from the thalamus, which grows around the ovary.

Q.21 Differentiate between:
(a) hypocotyl and epicotyl;
(b) coleoptile and coleorhiza;
(c) integument and testa;
(d) perisperm and pericarp.

Ans.

(a) Hypocotyl and Epicotyl

Hypocotyl Epicotyl
1. The cylindrical portion of the embryonal axis below the level of cotyledons is called the hypocotyl. 1. The portion of the embryonal axis above the level of cotyledons is called the epicotyl.
2. It is the portion of the embryonal axis that lies between the radicle and point of attachment of cotyledons. 2. It is the portion of the embryonal axis that lies between the plumule and cotyledons.
3. It terminates within the radicle or root tip. 3. It terminates within the plumule or stem tip.
4. It forms an important part of the embryonic root system. 4. It forms an important part of the embryonic shoot system.

(b) Coleoptile and Coleorhiza

Coleoptile Coleorhiza
1. It is the conical protective sheath which encloses the shoot apex and a few leaf primordia in a monocot seed. 1. It is the undifferentiated sheath which encloses the radicle and root cap in a monocot seed.
2. It forms the portion of the embryonal axis above the level of attachment of scutellum. 2 It forms the portion of the embryonal axis below the level of attachment of scutellum.
3. It forms the shoot system in adult plant by coming out from the soil and performs photosynthesis. 3. It remains inside the soil and is non-green in colour.

(c) Integument and Testa

Integument Testa
1. The integument is the outermost layer of the ovule. It acts as a protective covering of the ovule. 1. The tesla is the outermost protective covering of the seed.
2. There are two thin integument layers called inner and outer integuments. The cells of the integument layer are living. 2. It is thick and made of dead cells.

(d) Perisperm and Pericarp

Perisperm Pericarp
1. Perisperm is the persistent remains of the nucellus (ovule) in the seed. 1. Pericarp is the wall of fruit formed by the ovarian wall.
2. It is the part of a seed. 2. It is the part of a fruit.

Q.22 Why do you think the zygote is dormant for sometime in a fertilized ovule?

Ans.

The zygote is dormant for sometime in a fertilized ovule as it waits till endosperm is developed. This is because endosperm ensures an ample supply of nutrition for the embryo. The primary endosperm cell starts its division immediately after double fertilization occurs in the embryo sac. The cells of this endosperm tissue are filled with reserve food material and are used for the nutrition of the developing embryo. This tissue becomes the food that the young plant will consume until the roots have developed after germination.

Q.23 What is triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.

Ans.

The fusion of one of the male gametes of the pollen grain with the two polar nuclei located in the central cell to produce a triploid, primary endosperm nucleus is called triple fusion. It takes place in the central cell of the embryo sac.

Process of triple fusion: The pollen grains have two cells, a vegetative cell and a generative cell. The latter divides and forms the two male gametes during the growth of the pollen tube through the style. Once it reaches the ovary, pollen tube enters the ovule through the micropyle and releases the two male gametes into the cytoplasm of synergid. One of the male gametes moves towards the egg cell and fuses with the egg cell. This results in the formation of a diploid cell called the zygote. The other male gamete moves towards the two polar nuclei located in the central cell and fuses with them to produce a triploid, primary endosperm nucleus. As this involves the fusion of three haploid nuclei, it is termed as triple fusion.

Three haploid nuclei; one male gamete and two polar nuclei are involved in the triple fusion.

Q.24 What is bagging technique? How is it useful in a plant breeding programme?

Ans.

There is always a need to improve the quality of food crops to achieve higher-level production with better qualities. This is achieved by artificial hybridization techniques where it is made sure that only the desired pollen grains are used for pollination and the stigma is protected from contamination (from unwanted pollens). This is achieved by the bagging technique. The female reproductive part of the flower is covered with a bag of suitable size, usually made of butter paper. This prevents contamination of its stigma with unwanted pollen. In case of a bisexual flower, anthers are removed from the flowers using a pair of forceps (emasculation) before covering the flower with bags. Once the stigma of the bagged flower attains maturity, mature pollen grains collected from anthers of the desired male parent is artificially dusted onto the stigma and the flowers are rebagged. Fruits are allowed to develop.

This is a very useful technique and has been widely utilized in plant breeding programme. This allows careful selection of parent plants with desired traits.

Q.25 What is self-incompatibility? Why does self-pollination not lead to seed formation in self-incompatible species?

Ans.

Self-incompatibility is a genetic mechanism of preventing self-pollen (from the same flower or other flowers of the same plant) from fertilizing the ovules. This is achieved by inhibiting pollen germination or pollen tube growth in the pistil. Self-incompatibility is a widespread mechanism in flowering plants that prevents inbreeding and promotes outcrossing. This genetic response is controlled by one or more multi-allelic loci and relies on a series of complex cellular interactions between the self-incompatible pollen and pistil. Example: The flowers of Brassicaceae family are self-incompatible due to the presence of a receptor kinase signalling pathway that is activated in the pistil leading to pollen rejection.

In self-incompatible species, seeds are not formed in the event of self-pollination because the flowers are genetically programmed to inhibit pollen germination or pollen tube growth in the pistil. There will be no fertilization and thus, no further development leading to seed formation in such flowers.

Q.26 Mention two strategies evolved to prevent self-pollination in flowers.

Ans.

The two strategies evolved by the flowers to prevent self-pollination are:

  1. In some species, pollen release and stigma receptivity are not synchronized. Either the pollen is released before the stigma becomes receptive or stigma becomes receptive much before the release of pollen.
  2. In some other species, the anther and stigma are placed at different positions so that the pollen cannot come in contact with the stigma of the same flower.

Q.27 What are chasmogamous flowers? Can cross-pollination occur in cleistogamous flowers? Give reasons for your answer.

Ans.

A flower that opens up to expose the anthers and the stigma is called a chasmogamous flower. A chasmogamous flower opens at maturity, exposing anthers (stamens) and stigma to allow fertilization.

No, cross-pollination cannot occur in cleistogamous flowers. The reason is that these flowers stay always closed which allows self-fertilization. A cleistogamous flower is usually smaller and requires less energy. The structures are such that they allow reproductive organs to make close contact, making fertilization more likely. Since the flower never opens up, no cross-pollination can occur in cleistogamous flowers, e.g., Oxalis, Viola, etc.

Q.28 With a neat diagram explain the 7-celled, 8-nucleate nature of the female gametophyte.

Ans.

The female gametophyte (embryo sac) develops from one of the functional megaspores arising from meiotic division while the remaining three degenerate. The nucleus of the functional megaspore divides mitotically to form two nuclei which move to the opposite poles, thus forming a 2-nucleate embryo sac. Mitotic division continues and forms 4-nucleate and later the 8-nucleate stages of the embryo sac. These mitotic divisions result in the division of nucleus however there is no wall formation. Only after the 8-nucleate stage, cell walls are laid down leading to the formation of a typical female gametophyte or embryo sac. Here, six out of eight nuclei are surrounded by cell walls. The remaining two nuclei, called polar nuclei are situated below the egg apparatus in a large central cell.

The cells are distributed in a very typical fashion within the embryo sac. Three cells are grouped at the micropylar end and constitute the egg apparatus. Out of these three cells, two are synergids and one is the egg cell. The synergids have special cellular thickenings at the micropylar tip called filiform apparatus, which play an important role in guiding the pollen tubes of the pollen grains into the synergids. Three cells located at the chalazal end are called antipodals. The large central cell has two polar nuclei. Thus, a typical angiosperm embryo sac, once matured, is called 7-celled, 8-nucleate structure.

Q.29 What is meant by monosporic development of female gametophyte?

Ans.

The process of formation of embryo sac of the female flower from a single megaspore is called the monosporic development of female gametophyte. Out of the four megaspores produced as a result of the meiotic division of the megaspore mother cell (by megasporogenesis), only one remains functional while the other three degenerate. The functional megaspore develops into a female gametophyte or an embryo sac.

Q.30 With a neat, labelled diagram, describe the parts of a typical angiosperm ovule.

Ans.

The ovule or megasporangium is a part of the gynoecium that represents the female reproductive part of a flower. The gynoecium consists of single or multiple pistils at the end of which is a bulged part called the ovary. Inside the ovary is the ovarian cavity where the placenta is located. Megasporangia, which are also called as ovules, arise from these placental cells inside the ovary.

Structure of ovule: The ovule is a small structure attached to the placenta by means of a stalk called funicle. The body of the ovule fuses with funicle in the region called hilum, thus serving as a junction between the ovule and funicle. Each ovule has one or two protective envelopes called integuments. The integuments encircle the ovule except at the tip where a small opening called the micropyle is organized. Opposite to the micropylar end is a region that represents the basal part of the ovule and is called chalaza.

The integuments enclose a mass of cells called nucellus. These are filled with abundant food reserve. The embryo sac or the female gametophyte is located in the nucellus. The single embryo sac located inside the ovule arises from a megaspore through reduction division.

Q.31 Arrange the following terms in the correct development sequence:

Pollen grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gametes.

Ans.

Male gametophytes are produced in stamens. An anther has 4 pollen sacs or microsporangia. When the anther is young, a group of compactly arranged homogenous cells called sporogenous tissue occupies the centre of each microsporangium. Each cell of the sporogenous tissue acts as a pollen mother cell and is capable of giving rise to a microspore tetrad. Each cell of the microspore tetrad is called a microspore. The microspore divides further by mitosis and forms a structure called pollen grain, which is an immature male gametophyte (containing a vegetative cell and a generative cell). This generative cell divides mitotically to give rise to two male gametes.

So, the correct developmental sequence is:

Sporogenous tissue – pollen mother cell – microspore tetrad – pollen grains – male gametes

Q.32 Differentiate between microsporogenesis and megasporogenesis. Which type of cell division occurs during these events? Name the structures formed at the end of these two events.

Ans.

The differences between microsporogenesis and megasporogenesis are:

Microsporogenesis Megasporogenesis
1. The process of formation of microspores from a pollen mother cell (PMC) through meiosis is called microsporogenesis. 1. The process of formation of megaspores from the megaspore mother cell (MMC) is called megasporogenesis.
2. It the process of formation of the male gametophyte. 2. It the process of formation of the female gametophyte.
3. It occurs inside 4 microsporangia located inside the anther. 3. It occurs inside the ovules of an angiosperm flower.
4. Several thousands of microspores or pollen grains are formed inside each microsporangium. 4. A single MMC differentiates in the micropylar region of the nucellus to form 4 megaspores; out of which three degenerate while one develops into female gametophyte (embryo sac).

Both microsporogenesis and megasporogenesis involve meiosis which results in the formation of haploid gametes from microspore and megaspore mother cells.

Microsporogenesis results in the formation of haploid microspores from the diploid microspore mother cells. Whereas, megasporogenesis results in the formation of haploid megaspore from the diploid megaspore mother cells.

Q.33 Name the parts of an angiosperm flower in which development of male and female gametophyte take place.

Ans.

The male gametophyte or the pollen grains develop in the microsporangia (pollen chamber) of bilobed structure called anther. The female gametophyte (embryo sac) develops from functional megaspore in the structure called megasporangium or ovule.

Q.34 Correct the following statements:
(a) Surgical methods of contraception prevent gamete formation.
(b) All sexually transmitted diseases are completely curable.
(c) Oral pills are very popular contraceptives among rural women.
(d) In E.T. technique, embryos are always transferred into the uterus.

Ans.

(a) Surgical methods of contraception do not prevent gamete formation. Instead, they block gamete transport and thereby prevent conception. In males, it is called ‘vasectomy’ (a small part of the vas deferens is cut and tied up through a small incision on the scrotum) whereas, it is called ‘tubectomy’ in females (a small part of the fallopian tube is cut and tied up through a small incision in the abdomen or through vagina).

(b) All sexually transmitted diseases are not completely curable. Except for hepatitis-B, genital herpes and HIV infections, all other STDs are completely curable if detected early and treated properly. Medical advancements have still not found a complete cure for hepatitis-B, genital herpes and HIV infections.

(c) Oral pills are not very popular contraceptives among rural women. Intra Uterine Devices (IUDs) are one of the most widely accepted methods of contraception in India. These devices are inserted by medically trained personnel in the uterus through the vagina. They work by either increasing phagocytosis of sperms within the uterus, by releasing the Cu (Copper) ions that suppress motility and viability of sperms, or by releasing hormones that make the uterus unsuitable for implantation.

(d) In embryo transfer (E.T.) technique, embryos are not always transferred into the uterus. Ova from the wife/donor (female) and sperms from the husband/donor (male) are collected and induced to form zygote under ideal lab conditions. The zygote or early embryo (with upto 8 blastomeres) is then transferred into the fallopian tube (ZIFT – zygote intra-fallopian transfer) and embryos with more than 8 blastomeres are transferred into the uterus (IUT-intra uterine transfer) for its further development.

Q.35 State True/False with explanation
(a) Abortions could happen spontaneously too. (True/False)
(b) Infertility is defined as the inability to produce a viable offspring and is always due to abnormalities/defects in the female partner. (True/False)
(c) Complete lactation could help as a natural method of contraception. (True/False)
(d) Creating awareness about sex related aspects is an effective method to improve reproductive health of the people. (True/False)

Ans.

(a) True

Explanation: Abortion is the termination of pregnancy by the removal or expulsion of a foetus or embryo from the uterus before the time of parturation. It can be spontaneous also, called miscarriage. Miscarriage mostly occurs due to chromosomal problems which make it impossible for the foetus to develop. Other possible causes of miscarriage may be drug and alcohol abuse, exposure to environmental toxins, hormone-related problems, infections, obesity, physical problems with mother’s reproductive organs, etc.

(b) False

Explanation: Infertility is defined as the inability to produce a viable offspring inspite of unprotected sexual intercourse. There can be many reasons for infertility such as physical abnormalities, congenital diseases, side-effect of drugs, weak immune system and psychological well being.

(c) True

Explanation: Complete lactation could help as a natural method of contraception however, it is effective only upto a maximum period of six months following parturition or child birth. This is based on the fact that ovulation and therefore menstrual cycle, do not occur during the period of intense lactation (first six months) following childbirth. Thus, it is said that as long as mother breast feeds the child completely, chances of conception are nil. However, the chances of failure of this method are also very high.

(d) True

Explanation: Reproductive health means total well-being in all the aspects of reproduction, e.g. physical, emotional, behavioural and social. Thus, a society with people who are well informed about the merits and demerits of sex-related issues will behave in accordance with it and thus; will remain healthy.

Q.36 What are the measures one has to take to prevent from contracting STDs?

Ans.

Sexually transmitted diseases (STDs) are diseases or infections which are transmitted through sexual intercourse and are caused by viruses and bacteria. Humans do not have a good level of immunity to any of the STDs. Early symptoms are mild but if left untreated, they result in serious complications later. Thus, STDs are a major threat to a healthy society. Prevention is the best cure for not contracting STDs. Some simple measures that should be taken to prevent STDs are as follows:

  1. Information and knowledge of the facts related to STDs.
  2. Avoiding sex with unknown partners or multiple partners.
  3. Using condoms during coitus (intercourse).
  4. Immediately visiting a qualified doctor for early detection and taking complete treatment if diagnosed with the disease.

Q.37 Suggest some methods to assist infertile couples to have children.

Ans.

Couples who are unable to conceive in spite of unprotected sexual intercourse are infertile couples. Many reasons contribute to infertility, for example, physical environment, congenital diseases, drugs and immunological health. In some cases, special techniques known as assisted reproductive technologies (ART) play a very important role in treating infertile couples. Various ART are as follows:

  1. In-vitro fertilisation or test-tube baby followed by ‘Embryo transfer’ (ET): This is a technique by which fertilisation is carried out outside the body under conditions similar to those inside the body. Ova from the wife/donor (female) and sperms from the husband/donor (male) are collected and induced to form zygote under ideal lab conditions. The zygote or early embryo (upto 8 blastomeres) is then transferred into the fallopian tube (ZIFT – zygote intra fallopian transfer) and embryos with more than 8 blastomeres are transferred into the uterus (IUT-intra uterine transfer) to complete its further development.
  2. Gamete intra fallopian transfer (GIFT): In this method, ovum is collected from a donor (female) and transferred into the fallopian tube of another female who cannot produce one, but can provide the right environment for fertilisation and further development of the embryo.
  3. Intra cytoplasmic sperm injection (ICSI): This is another very specialised technique where sperm is directly injected into the ovum under laboratory conditions.
  4. Artificial insemination (AI): The semen collected either from the husband or a healthy donor is artificially introduced either into the vagina or into the uterus of the female. This technique is useful in those cases where the sperm count in semen is either very low or male partner cannot inseminate.

Q.38 Amniocentesis for sex determination is banned in our country. Is this ban necessary? Comment.

Ans.

Amniocentesis is a medical process in which a long needle is passed through the abdominal wall of the pregnant mother to withdraw a small amount of amniotic fluid along with foetal cells. These cells are used for karyotyping to detect any kind of chromosomal abnormality. The main application of the technique is in pre-natal diagnosis of chromosomal abnormalities and can be carried out after 16th week of pregnancy. Karyotyping not just gives information about the autosomal chromosomes, but also about sex chromosomes and thus, sex of the foetus can be determined through amniocentesis. In many places across India, birth of girl child is not desirable for various socio-economic reasons. Thus, people do not want a girl child. Therefore, they go for tests, like amniocentesis to find out the sex of the foetus. If they find that the foetus is a female child, they go for abortion. This is an illegal practice and leads to skewed male:female ratio in the society. In order to curb this, amniocentesis for sex determination has been banned in our country.

Q.39 Removal of gonads cannot be considered as contraceptive option. Why?

Ans.

Contraceptive methods should be user-friendly, easily available, effective and reversible with no or least side effects. Removal of gonads cannot be considered as contraceptive option because of following reasons:

  1. Complete removal of gonads will not just result in infertility, but will also devoid body of the hormones, released from these organs, which are important for normal functioning of other organs.
  2. This is an irreversible process and thus, couple can never conceive again after gonads are removed.

Q.40 Is the use of contraceptives justified? Give reasons.

Ans.

Contraceptives are devices, drugs, agents, sexual practices, or surgical procedures that prevent conception or pregnancy. Contraception helps women plan if and when they want to conceive. The use of contraceptives is very much justifiable due to the following reasons:

  1. It helps in checking population growth.
  2. Couples can plan when they want to have children and how many, without affecting their married life.
  3. Contraceptives prevent unwanted pregnancies and spread of sexually transmitted diseases (STDs).

Q.41 What are the suggested reasons for population explosion?

Ans.

When the number of people in a group exceed the carrying capacity of the region due to rapid increase of a population it is called population explosion. Population of most of the developing countries has drastically increased. According to an estimate, by 2050 the world’s population will be between 7.9 billion and 10.9 billion. If this trend continues, very soon there will be massive scarcity of basic requirements like food, shelter, clothing, etc. Some of the suggested reasons for this population explosion have been all-round development and successful implementation of programs in various fields of reproductive health. Awareness and availability of better health facilities along with better living conditions are one of the major reasons for population explosion. A rapid decline in death rate, maternal mortality rate and infant mortality rate as well as increase in number of people in reproductive age are some other major reasons for an alarming increase in population.

Q.42 Do you think that reproductive health in our country has improved in the past 50 years? If yes, mention some such areas of improvement.

Ans.

Yes, reproductive health in our country has improved in the past 50 years. This has been made possible by the successful implementation of various action plans, strong infrastructural facilities, professional expertise and material support. Some such areas of improvements are as follows:

  1. A statutory ban on amniocentesis (chromosome-based sex determination test) has resulted in a decline in female foeticide.
  2. Good medical assistance and care with better techniques and new strategies have helped overcome reproduction-related problems like pregnancy, delivery, STDs, abortion, contraception, infertility, etc. to a large extent. These steps have resulted in the rapid decline of maternal mortality and infant mortality rate.
  3. Massive child immunisation program has also been another successful program that has resulted in decreased infant deaths and healthy children.
  4. Large scale use of contraceptive methods due to massive awareness programmes and their easy availability have resulted in smaller families, thus checking the population growth.

Q.43 Is sex education necessary in schools? Why?

Ans.

Sex education is very important in schools as it provides the youngsters correct knowledge about various aspects of reproductive health like: reproductive organs, adolescence and related changes, safe and hygienic sexual practices, sexually transmitted diseases (STDs), etc. This would not just help them lead a normal healthy life, but also protect them from acquiring STDs and stay protected from sex abuse and sex-related crimes. The right information would discourage children from believing in myths and having misconceptions about sex-related aspects. This would help create a sexually conscious and healthy society.

Q.44 Suggest the aspects of reproductive health which need to be given special attention in the present scenario.

Ans.

Aspects of reproductive health which need to be given special attention in the present day scenario are:

  • Proper information about reproductive organs, adolescence and related changes, safe and hygienic sexual practices, sexually transmitted diseases (STD), etc., so that people can lead a normal and healthy life.
  • Sex education in schools should be made compulsory to help children understand the right facts about sexual practices and reproduction.
  • Proper information should be made available to fertile couples and people in marriageable age group about available birth control options, care of pregnant mothers, post-natal care of the mother and child, the importance of breastfeeding, etc., for the well-being of mother and child.
  • Society needs to be educated about the importance of bringing up a male and female child with equal opportunities so that female foeticide can be curbed.
  • People should be made aware of the problems society faces when there is uncontrolled population growth resulting in social evils like sex-abuse and sex-related crime.

Q.45 What do you think is the significance of reproductive health in a society?

Ans.

According to World Health Organization, health means a state total well-being in all the aspects like: physical, emotional, behavioural and social. A society with people having physically and functionally normal reproductive organs with normal interactions among them in all sex-related aspects is called reproductively healthy society. The importance of reproductive health is as follows:

  1. The offspring of healthy parents will be healthy, thus the overall health of society will be good, in all aspects of life.
  2. Proper information about reproductive organs, adolescence and related changes, safe and hygienic sexual practices, sexually transmitted diseases (STDs), etc., will help people lead a healthy life.
  3. A reproductively healthy society will have correct information about pregnancy, child-birth and post-natal care. This will keep the mother and the child lead healthy and happy life. Such societies will well address the problems of uncontrolled population growth, sex-abuse and sex-related crime, etc.

Q.46 Why are offspring of oviparous animals at a greater risk as compared to offspring of viviparous animals?

Ans.

Animals are classified into oviparous and viviparous based on whether the development of the zygote after fertilization takes place outside or inside the body of the female partner. Oviparous animals lay fertilised or unfertilised eggs and viviparous animals give birth to young ones.

The fertilised eggs of oviparous animals (like reptiles and birds), covered by the hard calcareous shell, are laid outside the body and after a period of incubation, young ones are hatched out. They are too young to protect themselves from predators or other environmental conditions. Thus, their chances of survival are less.

However, in the case of viviparous animals, (like most mammals, including humans) the zygote develops into a young one inside the body of the mother under perfect conditions. They come out of the mother’s body only after they have attained a certain developmental stage. Since they get better embryonic care and protection, the chances of survival are more in the offspring of viviparous animals.

Q.47 Examine a few flowers of any cucurbit plant and try to identify the staminate and pistillate flowers. Do you know any other plant that bears unisexual flowers?

Ans.

Cucurbits are usually climbing or trailing plants such as squash, pumpkin, cucumber, gourd, watermelon, etc. They have distinct, male and female flowers. Male (staminate) and female (pistillate) flowers, also called unisexual flowers, are found on a single plant (monoecious). These flowers have five fused petals with five stamens (male) or an inferior ovary (female). The male flowers tend to open first, followed by the female flowers. Pollination occurs only when both the male and female flowers open. The female flower opens for only one day.

Other examples of plants bearing unisexual flowers are:

Papaya, watermelon, muskmelon, castor, maize

Q.48 What is a bisexual flower? Collect five bisexual flowers from your neighbourhood and with the help of your teacher find out their common and scientific names.

Ans.

A bisexual flower is a flower that has both the essential whorls i.e., androecium and gynoecium (male and female reproductive units). They are also called as perfect flowers. Such flowers usually have numerous stamens.

The given table shows the common names and scientific names of some bisexual flowers.

Examples of bisexual flower Scientific name
Water Lily Nymphaeaceae
Rose Rosa
Sweet Pea Lathyrus odoratus
China rose Hibiscus rosa-sinensis
Mustard Brassica

Q.49 Describe the post-fertilisation changes in a flower.

Ans.

The post-fertilisation events are the events in sexual reproduction that take place after the formation of zygote. In flowering plants, the zygote is formed inside the ovule. As soon as the fertilisation takes place, the sepals, petals and stamens of the flower wither and fall-off. The pistil, which is the female reproductive organ of the plant, remains attached to the plant. The zygote develops into an embryo and the ovules develop into the seeds. The ovary develops into fruit which develops a thick wall called pericarp. This works as a protective covering of the fruit.

Q.50 Differentiate between gametogenesis from embroyogenesis.

Ans.

Gametogenesis is the formation of haploid male and female gametes from diploid meiocytes through the process of meiosis. The two gametes produced can be similar in appearance, like in some algae but usually, they are morphologically different, like in most sexually reproducing organisms.

Embryogenesis is the process of development of an embryo from the zygote. The zygote undergoes repeated mitotic cell divisions increasing the cell number and cell differentiation resulting in the generation of specialised cells (followed by tissues and organs) to carry out specific cellular functions.

Q.51 Differentiate between a zoospore and a zygote.

Ans.

The differences between a zoospore and a zygote are as follows:

Zoospore Zygote
1. A zoospore is the most common asexual structure (microscopic motile structure) formed in several algae and fungi. 1. A zygote is the result of the fusion of male and female gametes.
2. It is a motile structure that uses flagella for its movement. 2. It is a non-motile structure.
3. It is produced by a single organism and is the result of the asexual mode of reproduction. 3. It is a result of the sexual mode of reproduction and is formed by two organisms.
4. It is haploid (n). 4. It is diploid (2n).

Q.52 Define external fertilisation. Mention its disadvantages.

Ans.

External fertilisation is the process in which the fusion of male and female gametes resulting in the formation of a diploid zygote occurs in the external medium (water), i.e. outside the body of the organism.
Disadvantages of external fertilisation are:

  1. Wastage of resources as a large number of gametes are to be produced and released in the external medium by parents to increase the chances of fusion of gametes.
  2. Offspring are extremely prone to predators; thus threatening their survival up to adulthood.

Q.53 Identify each part in a flowering plant and write whether it is haploid (n) or diploid (2n).
(a) Ovary __________
(b) Anther __________
(c) Egg __________
(d) Pollen __________
(e) Male gamete __________
(f) Zygote __________

Ans.

Part of the Plant Haploid (n)/ Diploid (2n)
(a) Ovary Diploid (2n)
(b) Anther Diploid (2n)
(c) Egg Haploid (n)
(d) Pollen Haploid (n)
(e) Male gamete Haploid (n)
(f) Zygote Diploid (2n)

Q.54 Explain why meiosis and gametogenesis are always interlinked?

Ans.

Meiosis is a special type of nuclear division which segregates one copy of each homologous chromosome into each daughter cell. It reduces the number of chromosomes to half forming haploid daughter cells. It also introduces genetic variation in the daughter cells due to the process of recombination. The process of formation of haploid gametes involved in the sexual mode of reproduction is called the gametogenesis and it takes place through meiosis. The genetic variations due to recombination during meiosis ensure better chances of survival of the offspring under different environmental conditions. Thus, the process of meiosis and gametogenesis are always interlinked.

Q.55 Higher organisms have resorted to sexual reproduction in spite of its complexity? Why?

Ans.

Higher organisms have resorted to sexual reproduction in spite of its complexity because in sexual reproduction the offspring, although similar to their parents, are not identical to them due to recombination of genes received from the mother and father. This recombination of genes produces genetic variations in the offspring. In this way, sexual reproduction leads to a greater variety of population. This means that a species (animal or plant) can adapt more quickly to the environmental changes. Sexual reproduction, therefore, accords diversity to the species by providing genetic variation. This helps in the evolution of the species.

Q.56 Define
(a) Juvenile phase,
(b) Reproductive phase,
(c) Senescent phase.

Ans.

(a) Juvenile phase: The period of growth from birth until an organism reaches a certain stage of maturity in life before it can reproduce sexually.

(b) Reproductive phase: The phase of life in an animal or a plant when it is matured enough to reproduce.

(c) Senescent phase: The phase of life when the body metabolism slows down and the plant or animal cannot propagate further or reproduce.

Q.57 What is vegetative propagation? Give two suitable examples.

Ans.

Vegetative propagation is a term commonly used for an asexual mode of reproduction in plants. The units of vegetative propagation, such as runner, rhizome, sucker, tuber, offset, bulb etc. (called vegetative propagules), are well-equipped to give rise to a new individual on their own. Only one parent is involved in the process. The offspring produced is phenotypically and genetically identical to the parent thus, advantageous traits are preserved. No special mechanism, such as pollination, is required as only one parent is involved in the reproduction. This is a faster mode of reproduction which saves time and energy. Vegetative propagules also help the plants to survive unfavourable weather conditions. Special characteristics or features of the plant are maintained but no variation is introduced.

Example:

(a) Some plants, such as Canada thistle and most bamboos, send out long underground stems that produce new plants, often at considerable distances from the original plant. Such plants can form enormous colonies of new plants within relatively few years.

(b) Plants, like potato, sugarcane, banana and ginger, give rise to new plants through vegetative propagation. Small plants emerge from the buds of potato tuber, and the rhizome of banana and ginger.

Q.58 Distinguish between asexual and sexual reproduction. Why is vegetative reproduction also considered as a type of asexual reproduction?

Ans.

The difference between asexual and sexual reproduction is as follows:

Asexual Reproduction Sexual Reproduction
1. A single parent is involved. 1. Two parents are involved.
2. It does not involve the fusion of male and female gametes. 2. It involves the fusion of male and female gametes.
3. There is no genotypic or phenotypic variation introduced in the asexual mode of reproduction. Identical individuals are produced (clones). 3. Genotypic and phenotypic variations are introduced in the sexual mode of reproduction. Individuals produced are not identical among themselves or with their parents.
4. It is a fast process and is not energy-intensive. 4. It is a slow process and is energy-intensive.
5. It is commonly seen in simpler single-celled organisms like yeast and fungi. 5. It is usually seen in higher animals and plants.
6. It is an advantageous mode of reproduction if the environment is constant. 6. It is an advantageous mode of reproduction if the environment is not constant.

Vegetative reproduction is a term commonly used for an asexual mode of reproduction in plants where new plants are obtained without the involvement of seeds or spores. The units of vegetative propagation, such as runner, rhizome, sucker, tuber, offset, bulb etc. (called vegetative propagules), give rise to new individual offspring on their own. Since only one parent is involved in the process, it is a type of asexual reproduction. The offspring produced is phenotypically and genetically identical to the parent.

Q.59 How does the progeny formed from asexual reproduction differ from those formed by sexual reproduction?

Ans.

The differences between the progeny formed from asexual reproduction and sexual reproduction are as follows:

Progeny from asexual reproduction Progeny from sexual reproduction
1. Progeny is phenotypically and genetically identical to the parent as only one parent is involved in the asexual mode of reproduction. 1. Progeny is phenotypically and genetically different from the parent as this mode of reproduction involves the fusion of two different gametes from two parents.
2. At least two or more progeny are formed. 2. At least one or more progeny are formed.
3. Lack of variation makes progeny less suitable under changing environmental conditions, thus chances of survival are less. 3. Variation from the parent as well as among themselves makes progeny more suitable to the changing environmental conditions, thus chances of survival are more.

Q.60 Offspring formed due to sexual reproduction have better chances of survival. Why? Is this statement always true?

Ans.

Offspring formed due to sexual reproduction have better chances of survival under changing environmental conditions due to variability introduced in their genotype. This occurs due to the recombination of genes during meiosis. The fusion of the two gametes from two different parents results in genotypically and phenotypically different offspring which might have better survival or adaptability to the changing environment. This does not hold true in case of the asexual mode of reproduction.

However, there might be cases where the genetic makeup of the new offspring is at certain disadvantages or results in offspring that are not suited to the environment. For such cases, this form of reproduction may turn out to be disadvantageous. Thus, the given statement does not always hold true.

Q.61 Why is the offspring formed by asexual reproduction referred to as clone?

Ans.

The term clone refers to the organisms or cells, which are genetically identical. In the asexual mode of reproduction, a single individual (parent) produces offspring. The offspring that are produced are not only identical to one another but are exact copies of their parent, therefore they are called ‘clones’. These clones are formed by the process of mitosis, thus they are phenotypically and genetically identical to their parent.

For example; in Protists and Monerans, the organism or the parent cell divides into two to give rise to new individuals. Amoeba reproduces by binary fission where the cell simply divides into two halves and each rapidly grows into two adults. Yeast reproduces by budding.

Q.62 Which is a better mode of reproduction sexual or asexual? Why?

Ans.

Sexual mode of reproduction is better than asexual reproduction.

Sexual reproduction involves gametes (eggs or sperms) produced by the same or different individuals which fuse to form a zygote. The zygote then grows and develops into an adult individual. The offspring inherits half of its genes from one parent and the other half from the other parent. Also, the gametes are produced by meiotic division where recombination introduces variation. Thus, the offspring has a different combination of genes than either parent. Such variations are very important and advantageous to the species under changing environmental conditions because the offspring might be better adapted to the new environment than either of the parents, resulting in better survival.

In the asexual mode of reproduction, offspring are produced by a single parent without the involvement of gametes. Only one parent is involved and the offspring have the same phenotype and genotype as that of the parent without any variations. As long as the environment remains the same, this mode of reproduction is beneficial but under changing environmental conditions, this might be very disadvantageous as the lack of variations may affect the adaptability and the offspring may not be able to survive.

Q.63 Why is reproduction essential for organisms?

Ans.

Reproduction is a biological process in which an organism gives rise to young ones (offspring) similar to itself. The young one grows, matures and again reproduces. This continuous process ensures that a species is maintained for long and does not become extinct. Organisms spend a lot of energy in the process of reproduction to ensure that their genes are passed on to the next generation. The best-fit organisms in nature are those who produce the most offspring and are best adapted to the environment. This way the continuity of life is maintained.

Q.64 Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics

Ans.

(a) Transcription: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. The segment of DNA, which is transcribed during the process of transcription constitutes the transcription unit and is comprised of a promoter, the structural gene and a terminator. All three types of RNA, namely, mRNA, tRNA, and rRNA are synthesised using the process of transcription.

DNA-dependent RNA polymerase catalyses the reaction of transcription using the template strand which has 3’ to 5’polarity. It binds to the promoter and initiates the transcription process. This process follows the base complementarity rule except for that adenosine pairs up with uracil instead of thymine. This process is also called elongation. Once the polymerase reaches the terminator sequence, the RNA polymerase along with the nascent RNA falls off from the template. The process of falling fo nascent RNA is called termination.

RNA polymerase by itself is capable of the only elongation. It takes the help of the initiation factor and termination factor to initiate and terminate transcription. mRNA generated during the transcription process in bacteria doesn’t require further processing, thus, translation can begin at the same time. However, in eukaryotes, there are two additional complexities associated with transcription:

  1. Different kinds of RNA polymerases catalyse the formation of different kinds of RNAs.
  2. The primary transcript, which contains both exons and introns, and is non-functional, is subjected to the process of splicing, capping and tailing.

(b) Polymorphism: It is a form of genetic variation in which a DNA molecule consists of the distinct nucleotide sequence at a particular site. It is a heritable mutation and can be in a population at a high frequency. It can arise due to mutation in somatic or germ cells. The mutations in germ cells are transmitted from parents to offsprings. This causes accumulation of various mutations in a population leading to variation and polymorphism.

(c) Translation: The process of polymerisation of amino acids to form a polypeptide chain using the information defined by the sequence of bases in the mRNA is called translation. This is an energy-driven process. The amino acids are first activated in the presence of ATP and linked to their cognate t-RNA (aminoacylation of tRNA). When two such charged tRNAs come in close proximity to each other, the formation of the peptide bond is favoured. Also, a catalyst required for this bond formation enhances the reaction. These two processes are carried out by very specialised cellular machinery called ribosomes. The ribosome consists of structural RNAs and about 80 different proteins. There are two subunits, which remain separated in their inactive state however when the smaller subunit encounters an mRNA, the process of translation begins. The larger subunit has two sites for the activated tRNAs to bind to, thus bringing amino acids in close proximity for the formation of the peptide bond. The ribosome also acts as a catalyst for the formation of the peptide bond.

A translational unit in mRNA is the sequence of RNA that is flanked by the start codon (AUG) and the stop codon and codes for polypeptides. mRNA has some characteristic sequences called untranslated regions (UTRs) for the efficient translation process, but they are not translated.

For initiation, the ribosome binds to the mRNA at the start codon (AUG) followed by the elongation phase of protein synthesis. During this stage, charged tRNAs sequentially bind to the appropriate codon in mRNA by forming complementary base pairs with the tRNA anticodon. The ribosome moves from codon to codon along the mRNA adding amino acids one by one till it reaches the stop codon. Release factor binding to the stop codon results in termination and release of the complete polypeptide from the ribosome.

(d) Bioinformatics: The application of computer technology to manage biological information is called bioinformatics. This is a field that combines the knowledge of computer science, statistics, mathematics, and engineering to process biological data. Computers gather, store, analyse and then integrate the information which is then applied to various method developments in biological systems. A major activity in bioinformatics is to develop software tools to generate useful biological knowledge out of existing data.

The branch of bioinformatics came into existence with the progress of the Human Genome Project when a large amount of data became publicly available. The main aim of this project was to determine the sequence of the entire human genome (approximately three billion base pairs). This systematic approach of deciphering information using computers helped drastically in gene discovery programs across the world using biological information.

With the use of Next Generation sequencing technologies, where massive data is being generated across the world for many animals and plants, the meaning and usefulness of bioinformatics have become all the relevant.

Q.65 Explain (in one or two lines) the function of the following:
(a) Promoter
(b) tRNA
(c) Exons

Ans.

(a) Promoter: A promoter is the part of DNA from where transcription of a particular gene is initiated and is usually located towards 5’-end of the structural gene on the coding strand, close of the gene it works for. It contains specific sequences and response elements that provide the binding site for RNA polymerase and other transcription factors that help in recruiting the RNA polymerase on the promoter.

(b) tRNA: tRNA is the adaptor molecule responsible for reading the genetic information on the mRNA and bringing in specific amino acid, thus translating the information on mRNA into a polypeptide. tRNA has an anticodon loop that has bases complementary to the code on mRNA and the other end, has an amino acid acceptor end to which amino acids bind.

(c) Exons: Exons are parts of DNA that are converted into mature messenger RNA (mRNA). These are the DNA sequences of a eukaryotic split gene that code for proteins. The exons are interrupted by introns.

Q.66 Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.

Ans.

The various types of nucleic acid polymerases involved in the following processes are:

a. Replication process (DNA to DNA): DNA-dependent DNA Polymerases

b. Transcription process (DNA to RNA): DNA-dependent RNA polymerase

Q.67 Mention any two autosomal genetic disorders with their symptoms.

Ans.

  1. Sickle cell anaemia: This autosomal recessive genetic disorder is caused by the substitution of glutamic acid by valine at the sixth position of the beta-globin chain of the haemoglobin molecule. This point mutation causes a physiological change in the haemoglobin, which in turn changes the shape of the RBC from biconcave disc to sickle-like structure.

Symptoms: Shortness of breath, dizziness, headaches, cold hands and feet and pale jaundiced skin.

  1. Phenylketonurea: This autosomal recessive genetic disorder leads to the absence of an enzyme that converts the amino acid phenylalanine to tyrosine. This causes the accumulation of phenylalanine, which in turn leads to the associated symptoms.

Symptoms: Mental retardation, seizures, delayed development, behavioural problems, and psychiatric disorders.

Q.68 Who had proposed the chromosomal theory of the inheritance?

Ans.

The chromosomal theory of inheritance was proposed by Walter Sutton and Theodore Bovery in 1902. The theory linked the inheritance of traits described in Mendelian Laws to the inheritance of chromosomes.

Explanation: The theory explains that chromosomes carried the factors described in Mendelian inheritance. It also stated that the chromosomes are linear structures with genes located at specific sites called loci along their length.

Q.69 What is point mutation? Give one example.

Ans.

A gene mutation involving the substitution, addition, or deletion of a single nucleotide base is called a point mutation.

Sickle-cell anaemia is caused by the substitution of glutamic acid by valine at the sixth position of the beta-globin chain of the haemoglobin molecule. This substitution is caused due to a point mutation that changes the nucleotide A to T in the coding strand of the DNA.

Sequence for Normal Haemoglobin (HbA gene)

ATG GTG CAC CTG ACT CCT GAG GAG AAG TCT GCC GTT ACT
START Val His Leu Thr Pro Glu Glu Lys Ser Ala Val Thr

Sequence for Sickle Cell Haemoglobin (HbS gene)

ATG GTG CAC CTG ACT CCT GTG GAG AAG TCT GCC GTT ACT
START Val His Leu Thr Pro Val Glu Lys Ser Ala Val Thr

Explanation:

Point mutations can have one of three outcomes.

Type of point mutation Outcome
Silent Mutation Altered codon corresponds to the same amino acid
Missense Mutation Altered codon corresponds to a different amino acid
Nonsense Mutation Altered codon corresponds to a stop signal

Point mutations may arise from spontaneous mutations that occur during DNA replication. The rate of mutation may be increased by mutagens which are physical, chemical or biological agents that increase the frequency of mutations above the normal level. Mutagens associated with cancers are often studied to learn about cancer and its prevention.

Sickle-cell anaemia is an autosome linked recessive trait that is transmitted from parents to offspring when both parents are carriers of the point mutated gene. The disease is controlled by a single pair of allele, HbA and HbS. Double recessive individuals of genotype HbSHbS show the disease phenotype. The heterozygous individuals are only carriers of the disease and are unaffected.

Q.70 Explain the following terms with example
(a) Co-dominance
(b) Incomplete dominance

Ans.

(a) Co-dominance is a genetic phenomenon where the F1 generation resembles both parents i.e. the two alleles of a gene are equally dominant and both are expressed in a heterozygous condition. ABO blood group is an example of co-dominance. The ABO blood group is controlled by gene I which has three alleles IA, IB and i. IA and IB produce two different types of antigens on the RBC while the I allele doesn’t produce any antigen. In an individual, with the genotype IAIB both the A and B antigens are expressed on the RBC because of co-dominance.

(b) Incomplete dominance refers to a phenomenon whereby one allele does not completely dominate another allele, and therefore the progeny resembles neither of the parents resulting in a new phenotype which is a mixture of parental phenotypes. For example, a cross between the purebred red (RR) and white (rr) flowered plants of snapdragon (Antirrhinum sp.). The F1 generation (Rr) of such a cross yields 100% pink flowers as opposed to the expected red colour. This is because the RR genotype is partially dominant in the recessive trait of white flowers. Therefore, the white pigment of the flowers is also expressed resulting in pink colour flowers.

Parents: Red (RR) X White (rr)

Gametes R R
r Rr Rr
r Rr Rr

Phenotype – 100% flowers Pink

Genotype – 100% Rr (Red trait shows incomplete dominance)

Parents: Pink (Rr) X Pink (Rr)

Gametes R r
R RR Rr
r Rr rr

Phenotype – 1:2:1::Red:Pink:White

Genotype – 1:2:1::RR:Rr:rr

Q.71 A child has blood group O. If the father has blood group A and mother blood group B, work out the genotypes of the parents and the possible genotypes of the other offspring.

Ans.

The child of a set of parents that have blood group A and B can only be of blood group O if the genotype of the parents is heterozygous having one allele as the gene “i” that expresses neither antigen A or B. Therefore the genotypes of the parents and the offspring will be:

Genotype Phenotype
Father IAi A
Mother IBi B
Offspring IA IB , IA I, IB I, ii AB, A, B, O

The following Punnet cross explains how the various genotypes and phenotypes are derived:

Parent: Father (IAi) X Mother (IBi)

Gametes IA i
IB IA IB IBi
i IAi ii

Progeny Genotype – IA IB: IA i: IB i:ii::1:1:1:1

Progeny Phenotype – AB:A:B:O:: 1:1:1:1

Explanation:

Human blood type is determined by co-dominant alleles. It means that in a heterozygous situation, both alleles are expressed. In the case of blood type, there are three different alleles that result in variable expression of antigens on the RBCs.

Allele Type Blood Group Antigen expressed on RBC
IA A Antigen A
IB B Antigen B
i O No Antigen (neither A nor B)

Each of us has two ABO alleles, one from each parent. A pair of allele is called the genotype for that trait. Since there are three alleles 6 different genotypes are possible at the ABO genetic locus.

Allele from
Parent 1
Allele from
Parent 2
Genotype of
offspring
Blood types of
offspring
A A AA A
A B AB* AB
A O AO A
B A AB* AB
B B BB B
B O BO B
O O OO O

*Two recombinations result in AB genotype resulting in 6 different genotypes.

Q.72 How is sex determined in human beings?

Ans.

Sex determination in humans is associated with sex chromosomes that are different between male and female individuals. Normal human females have two sex chromosomes – XX. The normal human male has 2 sex chromosomes – XY. The males produce two different types of gametes one having the X chromosome and one with the Y chromosome, while all-female gametes have an X chromosome. The sex of the baby is determined by whether the fertilising sperm contains the X or the Y chromosome. There is an equal probability of having a girl or a boy for each fertilisation event.

Parent: Male (XY) X Female (XX)

Gametes

X

Y

X

XX

XY

X

XX

XY

Progeny Genotype – XX:XY::1:1

Q.73 What is pedigree analysis? Suggest how such an analysis can be useful.

Ans.

Pedigree analysis is a type of genetic analysis that analyses the pattern of inheritance of a particular trait, disease or abnormality. This type of analysis is made in several generations of a family using special symbols and lines.

Uses of pedigree analysis:

  1. Can help to determine if the trait is dominant or recessive
  2. Whether the trait is linked to the sex chromosome

Predict and trace the pattern of inheritance of single mutation disorder like Haemophilia, sickle cell anaemia etc so that parents who are carrying the mutated genes or belong to families afflicted by these disorders can make an informed decision about their progeny.

Q.74 Briefly mention the contribution of T.H. Morgan in genetics.

Ans.

Morgan formulated the theory of inheritance of chromosomes. He performed several dihybrid crosses in Drosophila to demonstrate linkage and recombination (the two terms coined by him) of genes on the X chromosome. He saw that some pair of contrasting characters did not segregate in the ratio of 9:3:3:1 (the expected outcome when the two genes are independent). Morgan attributed this to the genes being physically linked in such a way that they didn’t segregate independently of each other. Recombination was the event that was used to describe the generation of non-parental gene combinations. He demonstrated that tightly linked genes showed very low recombination while others that were loosely linked showed a higher rate of recombination. Morgan won the Nobel Prize in Physiology or Medicine in 1933 for his contribution to genetics.

Q.75 Two heterozygous parents are crossed. If the two loci are linked what would be the distribution of phenotypic features in F1 generation for a dibybrid cross?

Ans.

When two genes are linked they do not follow the expected ratio for a dihybrid cross between heterozygous parents as seen in Mendel’s crosses (9:3:3:1). Instead, the phenotype ratio will be like that of a monohybrid cross if the two genes are very tightly linked because they will be inherited together. Recombinant phenotypes may also appear in low numbers or varying numbers depending on the distance/extent of linkage between the two loci.

Q.76 When a cross is made between tall plant with yellow seeds (TtYy) and tall plant with green seed (Ttyy), what proportions of phenotype in the offspring could be expected to be
(a) Tall and green
(b) Dwarf and green

Ans.

A dihybrid cross between two parents differing in two pairs of contrasting traits: Plant height and seed colour was made using a Punnet square.

Parent: TtYy X Ttyy

Gametes TY Ty tY ty
Ty TTYy

(tall, yellow)

TTyy

(tall, green)

TtYy

(tall, yellow)

Ttyy

(tall, green)

ty TtYy

(tall, yellow)

Ttyy

(tall, green)

ttYy

(dwarf, yellow)

Ttyy

(dwarf, green)

Number of offspring with phenotype

(a) Tall and Green – 3

(b) Dwarf and Green – 1

Explanation: This phenomenon is based on Law of Independent assortment coined by Mendel in which he states that when two pairs of traits are combined in a hybrid, segregation of one pair of characters is independent of the other pair of characters.

Q.77 Using a Punnett Square, workout the distribution of phenotypic features in the first filial generation after a cross between a homozygous female and a heterozygous male for a single locus.

Ans.

Let us assume that the man is heterozygous for the blood group antigen AB and the female is homozygous BB. The first filial generation of the two parents will have the following distribution:

Parents: Female (BB) X Male (AB)

Gametes

B

B

A

AB

AB

B

BB

BB

Progeny Genotype – AB:BB::1:1

Progeny Phenotype – AB:B::1:1

Therefore in this situation, the phenotypic and genotypic ratio of the progeny will be the same. Also, the genotype of the female and male will be equally expressed.

Q.78 Define and design a test-cross.

Ans.Q.heterozygous.

Test cross design:

Plants with violet flowers (dominant trait; unknown genotype WW/Ww) were crossed with a purebred line yielding white flowers. The outcome of the experiment determines the genotype of the parent with the dominant trait. If all offspring yield violet flowers the parent with the dominant trait would be homozygous (WW) whereas, if the offspring yield both violet and white flowers 50% of the times the parent with the dominant trait would be heterozygous (Ww).

Parents: Violet (unknown parent could be WW/Ww) X White (ww)

Gametes

W

W

w

Ww

Ww

w

Ww

Ww

Phenotype – 100% flowers Purple

Inferred parental genotype – WW

Offspring Genotype – Ww

Parents: Violet (unknown parent could be WW/Ww) X White (ww)

Gametes

W

w

w

Ww

ww

w

Ww

ww

Phenotype – 50% flowers purple, 50% flowers white

Inferred parental genotype – Ww

Offspring Genotype – 50% Ww, 50% ww

Q.79 Explain the Law of Dominance using a monohybrid cross.

Ans.

According to Mendel’s Law of Dominance, a physical trait is controlled by a pair of factors (also called alleles). When the factors are dissimilar one factor dominates (dominant factor) the other (recessive factor). But the recessive factor is not lost and appears in the second generation.

This law is explained by a monohybrid cross which is a cross of two parents that are pure for one contrasting trait, for example, tall (TT) and dwarf (tt). The F1 generation yields all the progeny with a heterozygous genotype Tt that express the dominant trait – Tall. The F2 generation which is a self cross (TtxTt) yields progeny with a phenotypic ratio of 3:1 ::: tall:short and a genotypic ratio of TT:Tt:tt::1:2:1. The recessive trait (dwarf plant) appears in the F2 generation which was masked by the dominant trait (tall plant) in the F1 generation.

Parents: TT (tall) X tt (dwarf)

F1 generation

Gametes T T
t Tt Tt
t Tt Tt

Genotype – Tt

Phenotype – Tall

Parents: Tt (tall) X Tt (tall)

F2 Generation

Gametes T t
T TT Tt
t Tt tt

Genotype – TT:Tt:tt::1:2:1

Phenotype – 3:1:: tall:short

Q.80 A diploid organism is heterozygous for 4 loci, how many types of gametes can be produced?

Ans.

Loci means the position on the chromosome at which a gene lies. If an organism is heterozygous for 4 loci it means that for four genes the organism has dissimilar alleles. During meiosis the alleles will segregate in 16 possible ways to form 16 different types of gametes given that the genes are not linked. If the genes are linked then the outcome could vary as two or more alleles could co-segregate.

Explanation: To calculate the number of possible gametes when an organism is heterozygous for a locus the formula is as follows:

Number of heterozygous genes in the organism Example Number of types of gametes
1 heterozygous gene Aa 2^1 = 2
2 heterozygous genes AaBb 2^2 = 4
3 heterozygous genes AaBbCc 2^3 = 8
4 heterozygous genes AaBbCcDd 2^4 = 16

*The above holds true for genes that are not linked and segregate independently.

Q.81 Differentiate between the following –
(a) Dominance and Recessive
(b) Homozygous and Heterozygous
(c) Monohybrid and Dihybrid

Ans.

(a) A dominant factor or allele expresses itself in the presence or absence of the recessive allele. For example in a pea plant tall, violet flowers, green pod etc. are dominant factors. A recessive factor or allele cannot express itself in the presence of the dominant character. For example in a pea plant dwarf, white flowers, yellow pods are recessive factors.

(b) A homozygous genotype is the one in which both the alleles for a trait are similar. The genotype can be homozygous for a dominant (TT) or a recessive (tt) trait. All gametes produced by the homozygous organism will carry the same allele. A heterozygous genotype is one in which the two alleles for a trait are different. This type of genotype will have both dominant and recessive allele for example Tt. The gametes produced will be of two kinds one will only carry the dominant allele and one will carry the recessive allele.

(c) A monohybrid cross is a cross between two pure breed parents that differ in only one pair of contrasting character. For example a cross between tall (TT) and dwarf (tt) pea plants. A dihybrid cross is a cross between two parents that differ in two pairs of contrasting characters. For example a cross between pea plants having round yellow (RRYY) and wrinkled green (rryy) seeds.

Q.82 Mention the advantages of selecting pea plant for experiment by Mendel.

Ans.

Mendel chose the pea plants to carry out his genetics experiment because of the following features:

  1. Pea plants have naturally occurring visible contrasting traits such as purple/white flowers, tall/dwarf plants, yellow/green pods etc.
  2. Peas are self-pollinating plants i.e. pollen from a flower fertilises the eggs of the same flower giving rise to purebred lines having the same trait generations after generations.
  3. Pea plants can be easily cross-pollinated by emasculation whereby, the stamen of the plant is removed and the pistil is dusted with the stamen of the desired parent.
  4. The life cycle of pea plants is short and they produce many seeds in one generation enabling the statistical analysis of the result.

Q.83 List any three important characteristics of a population and explain.

Ans.

Three important characteristics of a population are population size, density, and growth rate.

1. Population size: In nature, single individuals of any species are not found in isolation. They live in well-defined geographical areas and share and compete for similar resources. At a particular time, they function as a unit that can be termed as population. The size of the population is governed by birth rates and death rates. The rates are expressed as change in numbers with respect to members of the population. The population also is characterized by sex ratio which means the number of males versus the number of females in a given population. The age distribution (percent individuals of a given age or age group) is another characteristic that is shown by a population. This governs the growth status of the population.

2. Population Density: Population density is the total number of individuals of a species per unit area or volume at any given time. For example the number of animals per square kilometre or the number of trees per hectare. The population density in an area may increase or decrease due to many factors like birth rate (natality), the death rate (mortality), migration (immigration and emigration) etc. Population density reflects the success of a species in any given area. Population density increases if the number of births and the number of immigrants is more than the number of deaths plus the number of emigrants, otherwise, it decreases. Under normal condition, birth and death are two factors which influence population density the most.

3. Growth Rate: The rate at which a population increases in a given time is called the growth rate. The availability of food and space is the most important criteria that affect the growth rate. When resources in a habitat are unlimited, each species can grow to its maximum capacity. This kind of population growth shows exponential growth. Nature cannot sustain exponential growth due to limitation in resources. This leads to competition among the members of the populations. The fittest survives and reproduces. A population growing in a habitat with limited resources initially show a lag phase, followed by a phase of exponential growth. The exponential growth of all populations is eventually curtailed by food availability, competition for other resources, predation, disease, or some other ecological factor. Once growth is limited by resources such as food, the exponential growth of the population begins to slow as competition for those resources increases. The growth of the population eventually slows nearly to zero as the population reaches the carrying capacity (K) for the environment which is the stage where the resources available in that habitat are just sufficient to sustain that population level in that geographical area. The result is an S-shaped curve of population growth known as the logistic curve. A plot of N (population density at time t) in relation to time (t) results in a sigmoid curve graph.

Q.84 Select the statement which best explains parasitism.
(a) One organism is benefitted.
(b) Both organisms are benefitted.
(c) One organism is benefitted, other is not affected.
(d) One organism is benefitted, other is affected.

Ans.

(d) Parasitism is best described as an interaction where one organism is benefitted while the other is affected. It is the interaction between two species in a given area which is beneficial for one species (parasite) but is detrimental to the other species (host).

Q.85 With the help of a suitable diagram describe the logistic population growth curve.

Ans.

A population growing in a habitat with limited resources initially shows a lag phase, followed by a phase of exponential growth. The exponential growth of all populations is eventually curtailed by food availability, competition for other resources, predation, disease, or some other ecological factor. Once growth is limited by resources such as food, the exponential growth of the population begins to slow as competition for these resources increases. The fittest individual survives and reproduces. The growth of the population eventually slows to zero as the population reaches the carrying capacity (K) for the environment which is the stage where the resources available in that habitat are just sufficient to sustain that population level in that geographical area. The result is an S-shaped curve of population growth known as the logistic curve. A plot of N (population density at time t) in relation to time (t) results in a sigmoid curve graph. This type of population growth is called Verhulst-Pearl Logistic Growth.

Q.86 Define the following terms and give one example for each:
(a) Commensalism
(b) Parasitism
(c) Camouflage
(d) Mutualism
(e) Interspecific competition

Ans.

(a) Commensalism: The interaction between two species in a given area where one species is benefitted and the other is neither benefitted nor harmed is called commensalism. For example, the cattle and egret relationship is a very classical example of commensalism. The egrets always forage close to where the cattle are grazing because the cattle, as they move, stir up and flush out the vegetation insects that otherwise might be difficult for the egrets to find and catch.

(b) Parasitism: The relationship or interaction between two species in a given area which is beneficial for one species (parasite) but detrimental to the other species (host) is called parasitism. For example, a tick feeding on a dog, a mosquito feeding on a human or a leech feeding on a human.

(c) Camouflage: The act, means, or result of obscuring because of colouration or patterns that help an animal to appear to blend with its surroundings is called camouflage. Camouflage is common among invertebrates. It is also common in a variety of other animals. It is used by prey to help hide from predators and it is used by predators to help them conceal themselves when they are out to prey. For example, leaf mimic Katydids, Sea dragon, Australian Leaf Insect

(d) Mutualism: The relationship between two species that confer benefits on both the interacting species is called mutualism. For example, the association between the sea anemone and hermit crab is another example of mutualism. The sea anemones give protection to the crab using its stinging cells, and it remoulds its shell to fit the crab while the hermit crab allows the sea anemones to consume the remains of its food, thus it also provides the sea anemones with food supply.

(e) Interspecific competition: Interspecific competition is a form of competition in the ecosystem where individuals of different species living in the same area compete for the food or living space. For example, competition among carnivores for prey is an example of interspecific competition. It does not have an equal impact on each competitor: the larger competitor usually wins. Lions are much larger than hyenas, so in this case, hyenas are subordinate.

Another example is the competition between plants which is observed in forests where large trees dominate the canopy and thus allow little light to reach smaller competitors living below.

Q.87 Define population and community.

Ans.

A population is defined as a group of all the organisms of the same species, who live in the same defined geographical area, have the capability of interbreeding and share common resources.

A community is defined as a group of various populations that share a common environment.

Q.88 Give an example for:
(a) An endothermic animal
(b) An ectothermic animal
(c) An organism of the benthic zone

Ans.

(a) An endothermic animal: Cow
(b) An ectothermic animal: Crocodile
(c) An organism of the benthic zone: Sea star

Q.89 List the various abiotic environmental factors.

Ans.

The major abiotic environmental (non-living components) factors are temperature, water, light and soil.

Q.90 Write a short note on
(a) Adaptations of desert plant and animals
(b) Adaptation of plants to water scarcity
(c) Behavioural adaptations in animals
(d) Importance of light to plants
(e) Effect of temperature or water scarcity and the adaptations of animals.

Ans.

(a) Adaptations of desert plant and animals: Adaptations of desert plants are the morphological and behavioural responses to maximise their chances of survival in desert (arid) regions. Scarcity of water is the main limiting factor that requires these plants to adapt to such an environment. Plants evincing adaptation to arid conditions are termed xerophytes.

  • Succulent plants store water in fleshy leaves, stems or roots from which it is not lost easily. All succulent plants have extensive, shallow root systems that allow them to absorb water efficiently. Example: Cacti, agaves, aloes, elephant trees and many euphorbias.
  • The stems and leaves of most species have waxy cuticles that make them nearly waterproof when the stomates are closed.
  • Water is further saved by reduced surface areas; most succulents have few leaves, no leaves (most cacti), or leaves that are deciduous in dry seasons.
  • Also, many succulents possess a water-efficient variant of photosynthesis called CAM (Crassulacean Acid Metabolism). CAM plants open their stomata for gas exchange at night. During the day, the stomata are closed. This helps the plant prevent water loss.

Desert animals face similar challenges for survival and have developed a multitude of adaptations to ensure their survival in the harsh conditions. Some of the adaptive responses to desert-dwelling are as follows:

Avoiding Heat:

  • They are active in the early morning and late evening when the temperatures are not very high.
  • Many animals are completely nocturnal such as bats, snakes, rodents foxes and skunks.
  • Various animals use shade and burrows or dens during the heat of the day.
  • Aestivation, dormancy during periods of heat and dryness is also witnessed.

Dissipating heat:

  • They keep their mouth open to exhaust body heat.
  • They have long appendages and enormous ears that act like the radiator of a car.
  • They are light coloured which reflects heat and acts as camouflage in desert surroundings.
  • They excrete faeces on the legs, where evaporation cools the rest of the body (birds).

Retaining water:

  • Many burrows into moist soil where water is absorbed through the skin.
  • Some obtaining their moisture needs from the food they eat.
  • Excreting metabolic wastes in the form of uric acid to conserve water.

Acquiring water:

  • Deriving water directly from plants, particularly succulents, such as cactus
  • Specialised kidneys that extract water from their urine.
  • Specialised organs that recapture exhaled moisture in the nasal cavities.
  • Manufacturing water metabolically from the digestion of dry food items.

b. Adaptation of plants to water scarcity: Environmental stresses of low rain, low relative humidity with desiccating winds, and high summer temperatures characterise climates of deserts and coupled with low nutrient availability, produce severe limitations to the plant growth. Despite such stresses, desert contains surprisingly large amounts of plant biomass, and possess remarkable diversity of plant growth forms. The following strategies are adopted by various plants to survive the water scarcity of deserts:

  • Drought-escaping plants: Plants that germinate and grow only when there is sufficient moisture available to complete their life cycle. Only their seeds persist during times of drought.
  • Drought-evading plants: Non-succulent perennials which restrict their growth activity to periods when moisture is available. Typically, they are drought-deciduous shrubs which go dormant or die back during dry periods.
  • Drought-enduring plants: Evergreen shrubs. The extensive root system is coupled with various morphological and physiological adaptations of their aerial parts enable these hardy xerophytes to maintain growth even in times of extreme water stress.
  • Drought-resisting plants: succulent perennials. The water stored in their swollen leaves and stems is usually used very sparingly.

c. Behavioural adaptations in animals: Adaptations help organisms survive in their ecological niche or habitat and it can be anatomical, behavioural or physiological. Behavioural adaptations can be inherited or learnt, including tool use, language and swarming behaviour and allow animals to respond to life needs. Behavioural adaptations are the things organisms do to survive usually in response to some type of external stimulus. They can be instinctive or learnt. Instinctive behaviour is natural and need not be taught to animals. Some examples are what the animals eat, how it moves around and how it protects itself. Migration, hibernation, dormancy, ways of finding food, raising young ones and camouflage are ways of instinctive behavioural adaptations shown by various animals across a range of ecosystem. Learned behaviour is learnt by interaction with the environment and cannot be passed on to the next generation except by teaching the young ones. In animals, behavioural adaptation depends on the level of intelligence shown by the animal, the wise animal will quickly learn to make behavioural changes, in order to survive and this change can happen quickly over time. Moving in large groups is an example of behavioural adaptation; it helps protect the members of the group from predators.

d. Importance of light to plants: Light plays an important role in the development of a plant. Plants produce food by the process of photosynthesis and light is essential for this process as it is the source of energy. Without light, plants cannot carry out photosynthesis and thus, no food will be produced. The phototropism (hormones that control plant growth begin to accumulate in the plant’s stem, forcing the plant towards the light) shown by plants is also dependent upon the availability of light. Thus photosynthesis and phototropism depend on the availability of light sources for plants. The flowering in many plants is dependent upon the availability of sunlight and season. The vertical distribution of aquatic plants in any water/marine ecosystem is also dependent upon the availability of sunlight.

e. Effect of temperature or water scarcity and the adaptations of animals: The abiotic factors like temperature and water play a very important role in the distribution and adaptation of animals. As we know, the average temperature on land varies seasonally, across the globe. It decreases from the equator towards the poles and from plains to the mountain tops. It ranges from subzero levels in polar regions and high altitudes to >50°C in tropical deserts in summer. Other unique ecosystems are thermal springs and deep-sea hydrothermal vents where the average temperature exceeds 100°C. Many animals can tolerate a wide range of temperature however most animals are restricted to a narrow temperature range. Snow leopards and polar bears are adapted to polar regions – they have a thick layer of fat below their skin and have thick fur. Plants and animals found in desert areas have adapted themselves well so that they can face high temperatures and shortage of water.

Water is another very important abiotic factor that affects the living beings and depending upon its availability and quality, life has adapted itself. Where there is water scarcity, living beings have adapted themselves by making several modifications in their morphology and physiology. The succulent leaves, thorns, long roots in plants are few modifications that have occurred over the years in desert plants. Organisms living in lakes, oceans and rivers also face water problems – it is quality of water like chemical composition, pH, which makes the impact. The salt concentration in water also affects the life forms – some can tolerate a wide range of salinities (euryhaline) but others are restricted to a narrow range (stenohaline).

Q.91 Distinguish between the following:

    1. Hibernation and Aestivation
    2. Ectotherms and Endotherms

Ans.

(a) Hibernation and Aestivation

Hibernation Aestivation
1. Hibernation is a dormant state during extreme winters in which hibernating animals go into a deep sleep and use stored body fat as the only source of energy. 1. Aestivation is a dormant state during extreme summer climate to avoid hot and desiccating environment.
2. They decrease their body temperature and metabolic activities to reduce energy consumption. By doing this they protect themselves from harsh cold weather and scarcity of food. 2. Aestivating animals usually go under the ground to avoid dehydration and high temperature. They also decrease their metabolism to reduce energy consumption.
Examples: chipmunks, hamster, polar bears Example: snakes and frogs

(b) Ectotherms and Endotherms

Ectotherms Endotherms
1. Ectotherms are the animals that depend upon the temperature of the surrounding environment to maintain their body temperature. 1. Endotherms are the animals who can maintain constant optimum body temperature on their own.
2. They absorb heat from the environment to keep themselves warm or they aestivate by going under the ground to avoid high temperature during summer because that will increase their body temperature too. 2. They maintain their body temperature mainly by the heat produced inside the body as a byproduct of metabolic reactions.
Examples: reptiles, amphibians and fishes Examples: Mammals and birds with a few exceptions.

Q.92 What is the ecological principle behind the biological control method of managing with pest insects?

Ans.

The ecological principle behind the biological control method of managing with pest insects is based on a very simple fact that the predators keep the prey population under check by consuming it e.g. all insect species are suppressed by naturally occurring organisms and environmental factors.

Q.93 An orchid plant is growing on the branch of a mango tree. How do you describe this interaction between orchid and the mango tree?

Ans.

This type of interaction, where one species gets benefitted and other is neither benefitted nor harmed, is called commensalism. Mango tree provides elevation to the orchid plant so that it can receive a sufficient amount of sunlight and air. The orchid plant receives nutrients mainly from the moist air around them and sometimes from decaying organic waste of host plant or other insects. They do not parasitize on mango tree, rather take only physical support. Thus, the orchid plant gets benefitted but it neither harms nor benefits the mango tree.

Q.94 Name important defence mechanisms in plants against herbivory.

Ans.

In nature, herbivores are the predators of plants. Plants cannot run away from predators unlike animals, so over the years, they have evolved several defence mechanisms to protect themselves from herbivores. These involve both morphological and chemical defence mechanisms, a few of which are listed below:

a. Morphological Defence Mechanisms

  1. Thorns e.g. Cactus, Acacia
  2. Mechanical protection on the surface of the plants e.g., hairs, trichomes, spines, and thicker leaves

b. Chemical Defence Mechanisms

  1. Many plants produce and store chemicals which are harmful to the herbivores e.g. weed Calotropis growing in the fields produce highly poisonous cardiac glycosides and thus, cattle do not eat it.
  2. Chemicals like nicotine, caffeine, quinine, opium, strychnine, that are extracted from plants for commercial reasons are actually produced by these plants as part of their defence mechanism.
  3. Indirect defences against insect herbivory are mediated by the release of a mixture of volatile compounds that specifically attract natural enemies of the herbivores and/or by providing food (e.g., extrafloral nectar) and housing to enhance the effectiveness of the natural enemies, thereby killing the herbivore.

Q.95 List the attributes that populations but not individuals possess.

Ans.

The attributes that populations but not individuals possess are mentioned below:

a. Birth Rate: It is the rate at which new individuals are added to the population due to birth and is also known as natality. The birth rate is the total number of births per 1,000 individuals of a population each year.

b. Death Rate: It is also known as mortality and is the number of deaths in a given population per unit of time. The mortality rate is typically expressed in units of deaths per 1000 individuals per year.

c. Sex Ratio: The ratio of males and females in a population. The sex ratio is an important attribute of a population and tells about the percent of females and males in the population.

d. Age Distribution: Age distribution is the proportionate number of persons in successive age categories in a given population at any given time. If the age distribution (percent individuals of a given age or age group) is plotted for a population, the resulting structure is called age pyramid. The shape of the pyramid reflects the growth status of the population and tells whether it is expanding, stable or declining.

e. Population Density: Population density is the total number of individuals of a species per unit area or volume at a given time e.g. number of animals per square kilometre or the number of trees in a given area etc. The population density in an area may increase or decrease due to many factors like birth rate (natality), the death rate (mortality), migration (immigration and emigration) etc. Population density reflects the success of a species in any given area.

Q.96 Most living organisms cannot survive at temperature above 45°C. How are some microbes able to live in habitats with temperatures exceeding 100°C?

Ans.

Most living organisms cannot survive at temperatures above 45°C. However, some microbes, known as thermophiles are able to live in habitats with temperatures exceeding 100°C due to the presence of enzymes which are stable to heat. These thermostable enzymes do not denature under high temperatures allowing the metabolic activities of bacteria to go on.

Q.97 Define phenotypic adaptation. Give one example.

Ans.

A form of biological adaptation in organisms that occurs through behavioural changes in individuals is called phenotypic adaptation. Such changes occur so that the organisms can cope well under the environmental conditions that they face in their natural habitat.

Example: Giraffes have long necks so that they can eat leaves from tall trees.

Q.98 If a marine fish is placed in a fresh water aquarium, will the fish be able to survive? Why or why not?

Ans.

The salt concentration in the sea is in the range of 30-35 (measured as salinity in parts per thousand) as compared to the freshwater aquarium in which salt concentration remains less than 5. The body of a marine fish is adapted to high salt concentration. If they are placed in freshwater, they cannot survive due to osmotic pressure problems. The water will enter their body through the process of osmosis (from low to high salt concentration) and the fish will not be able to bear the sudden change in the osmotic pressure. The body will swell and eventually burst.

Q.99 How is diapause different from hibernation?

Ans.

Diapause and hibernation are both ways to avoid the stress of the unfavourable environment. When animals want to avoid cold winter season, they undergo a state of suppressed metabolic activities or become dormant and this is called hibernation. They hide in their shelters, thereby avoiding the harsh winter climate. This phenomenon is commonly seen in bears, rodents, etc. Diapause is a stage of suspended development and reduced physiological activity under unfavourable environmental conditions. This is mostly seen in zooplankton species in lakes and ponds.

Q.100 What is DNA fingerprinting? Mention its application.

Ans.

DNA fingerprinting is a quick way to compare the DNA sequences of any two individuals. 99.9% of base sequence among individuals is similar; it is only the remaining 0.1% which gives distinguishing characteristics to each individual. Now, if one needs to find out genetic differences between two individuals in a population, sequencing 3X109 bases every time would be a very time consuming and expensive affair. DNA fingerprinting is a way to identify differences in some specific regions in the DNA known as VNTR (Variable number of tandem repeats) repetitive DNA or more specifically, microsatellites, to make identification much easier. Microsatellites are short pieces of DNA which repeat many times in a given person’s DNA. By comparing a number of microsatellites in a given area, one can identify a person easily.

Applications of DNA fingerprinting:

1. In paternity issues since polymorphisms are inherited from parents to children.

2. In forensic crime analysis (using blood, hair-follicle, skin, saliva, semen, etc)

3. In population genetics to analyse variation within the population.

4. In conservation biology to study the genetic variability of endangered species.

5. In evolutionary biology to compare DNA extracted from fossils to present-day animals or humans.

Q.101 Why is the Human Genome project called a mega project?

Ans.

The quest to find differences between two individuals at a gross level due to differences at the DNA level lead to a very ambitious project in the 1990s. This mega project was called the Human Genome Project (HGP). The goal was to discover the genetic make-up of individuals to the DNA level. With the establishment of precise genetic engineering methods, it became possible to clone any sequence of DNA and availability of simple and fast DNA sequencing techniques made HGP a possibility.

The goals of the Human Genome Project were:
a. To identify all the genes in human DNA which were estimated to be around 20,000-25,000.
b. To determine the sequence of 3 billion base pairs which make up the entire human genome.
c. To store this massive information in properly catalogued databases.
d. To improve data analysis tools to analyse the generated data.
e. To address the ethical, legal and social issues arising out of the project.

The human genome is said to have approximately 3 X 109 base pairs. With the cost of sequencing each base way back in the 1990s to be around US $ 3 per base pair, the total estimated cost of the entire HGP was calculated to be around 9 billion US dollars. Further, it was calculated that around 3300 books (of 1000 pages with 1000 letters typed on each page) would be required to store the data generated by sequencing of a single human cell. This enormous data necessitated the need for high-speed computational devices for data storage, retrieval and analysis.
Human Genome Project took 13 long years to finish. It was coordinated by the U.S. Department of Energy and the National Institute of Health. During the early years of the HGP, the Wellcome Trust (U.K.) became a major partner with support coming to Japan, France, Germany, China and others. The project was completed in 2003.
These were the reasons to term Human Genome Project as a mega project.

Q.102 In the medium where E.coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?

Ans.

The lac operon consists of one regulatory gene (the i gene – the term i is derived from the word inhibitor) and three structural genes (z, y and a). The i gene codes for the repressor of the operon. The z gene codes for beta-galactosidase (β-gal), which is responsible for the hydrolysis of the sugar lactose into monomeric units, galactose and glucose. The y gene codes for permease, which increases cell permeability to β -galactosidases. The a gene encodes a transacetylase. Hence, all three genes of the operon are involved in lactose metabolism.

Lactose which is the substrate for the enzyme β –galactosidases, also acts as an inducer of the operon by switching on and off of the operon. When lactose is provided in the medium as a carbon source, it is transported into the cells by the action of a little amount of permease present in the cell. This lactose then induces the operon by inactivating the repressor. When lactose was absent, the repressor produced by the i gene remains bound to the operator region and prevents RNA polymerase from transcribing the operon. Once the repressor is inactivated in the presence of lactose, RNA polymerase initiates the transcription process.

However, after sometime, the lac operon shuts down because of catabolite repression of the lac operon. The level of lactose decreases and that of glucose rises. If lactose and glucose are present, the cell will use glucose before the lac operon is turned on. This type of control is termed catabolite repression. To prevent lactose metabolism, the second level of control of gene expression exists. The promoter of the lac operon has two binding sites. One site is where RNA polymerase binds. The second location is the binding site for a complex between the catabolite activator protein (CAP) and cyclic AMP (cAMP). The binding of the CAP-cAMP complex to the promoter site is required for transcription of the lac operon. The presence of this complex is closely associated with the presence of glucose in the cell. With the increase in the concentration of glucose, the amount of cAMP decreases. Thus, the amount of complex decreases. This decrease in the complex inactivates the promoter, and the lac operon is turned off. Because the CAP-cAMP complex is needed for transcription, the complex exerts positive control over the expression of the lac operon.

Q.103 List two essential roles of ribosome during translation.

Ans.

The translation is the process of making proteins using cellular machinery with the help of specialised units called ribosomes. During translation, the information carried by messenger RNA (mRNA) produced by transcription is translated into a polypeptide using the ribosome complex. The order and sequence of amino acids are defined by the sequence of bases in the mRNA. The amino acids are joined by a bond called peptide bond and this process requires energy. In the first phase of the process, the amino acids are activated in the presence of ATP and linked to their cognate tRNA, which acts as an adaptor molecule. When two such charged tRNAs come in close proximity, the formation of a peptide bond occurs between the two loaded amino acids. A catalyst is needed for this entire process. This is where the machinery of ribosomes comes into action in the following ways:

a. The ribosome consists of structural RNAs and about 80 different proteins. There are two subunits, which remain separate in its inactive state however when the smaller subunit encounters an mRNA, the process of translation begins. The larger subunit has two sites for the activated tRNAs to bind, thus bringing amino acids in close proximity for the formation of a peptide bond.

b. It also acts as a catalyst for the formation of the peptide bond.

Q.104

Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNA and tRNA
(c) Template strand and Coding strand

Ans.

(a) Repetitive DNA and Satellite DNA

Repetitive DNA Satellite DNA
Repetitive DNA is the sequence of DNA in the genome where a small stretch is repeated many times. The repetitive DNA code for proteins. Satellite DNA does not code for any protein but forms a large portion of tandemly repeating DNA like centromeric region.

(b) mRNA and tRNA

mRNA tRNA
1. It is known as messenger RNA. 1. It is known as transfer RNA.
2. mRNA is the template, which helps to translate the genetic information coded by the DNA into proteins. 2. tRNA carries amino acids to the ribosomes for protein synthesis. It acts as an adaptor molecule between mRNA and ribosomes for the synthesis of proteins.

c. Template strand and Coding strand

Template strand Coding strand
In the double helix, the DNA strand that has the polarity 3’to 5’ and also acts as a template for coding the mRNA is referred to as a template strand. The strand of the double helix with 5’ to 3’ polarity, which is displaced during transcription is called the coding strand. It has sequenced the same as that of mRNA (except thymine at the place of uracil).

Q.105 How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?

Ans.

Hershey and Chase grew some bacteriophages on a medium containing radioactive phosphorus and some others on medium containing sulphur. Viruses grown on the radioactive phosphorus contained radioactive DNA since phosphorus is part of DNA however, their protein was normal. On the other hand, viruses grown on the radioactive sulphur had radioactive protein, not the DNA since sulphur is the part of the protein.

Then, they went ahead with these radiolabelled bacteriophages (cultures in which either the protein capsule is labelled with radioactive sulphur or the DNA core is labelled with radioactive phosphorus) to infect E.coli host in two separate set of experiments followed by agitation in a blender to dislodge phage particles from bacterial cells and centrifugation to concentrate cells, separating them from the phage particles left in the supernatant.

Result: They checked for the presence of radioactivity in these two sets of experiments and the following observations were made:

a. Radioactivity was detected in bacteria, which were infected with viruses containing radioactive phosphorus and therefore, radioactive DNA. No radioactivity was detected in the supernatant which contained the protein head. New generation of radioactive and infective phages could be isolated from this culture. This suggested that radioactive DNA has entered the bacterial cell.

b. The other set of bacteria which were infected with bacteriophages labelled with radioactive sulphur had no radioactivity in them. Instead, the entire radioactive sulphur was detected in the supernatant. This indicated that protein did not enter the bacterial cell.

Therefore, this experiment clearly showed that it is the DNA, not protein that acts as genetic material and passes the information from one generation to the next.

Q.106 Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

Ans.

The specific base pair property of nucleotides (Adenosine pairing with Thymine and Cytosine pairing with Guanine) in DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication. They proposed that the two strands of a DNA molecule separate during replication (the process of duplication of DNA). After separation, each strand acts as a template for the synthesis of the new strand, following the base-pairing rule. Thus, the new DNA double helix that is created has one parental strand and one new strand. This scheme is referred to as semi-conservative DNA replication.

Q.107 If the sequence of the coding strand in a transcription unit is written as follows:
5’-ATGCATGCATGCATGCATGCATGCATGC–3’.
Write down the sequence of mRNA.

Ans.

mRNA sequence:

5’- AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3’

Explanation: The process of converting genetic information from one strand of the DNA into RNA is termed as transcription. It is the template strand is for mRNA synthesis. The coding strand in a transcription unit does not code for any mRNA but has a sequence similar to mRNA except that uracil replaces thymine.

Q.108 If the sequence of one strand of DNA is written as follows:
5′ -ATGCATGCATGCATGCATGCATGCATGC-3′
Write down the sequence of complementary strand in 5’→3′ direction.

Ans.

The sequence of the complementary strand in 5’to 3’direction:

5’-GCATGCATGCATGCATGCATGCATGCAT -3’

Explanation: The two complementary (A pairs with T and G pairs with C) strands of double-stranded DNA have anti-parallel polarity. It means, if one strand is 5’to 3’, the other will be 3’to 5’. Thus, the complementary strand will be

5’- ATGCATGCATGCATGCATGCATGCATGC – 3’

3’- TACGTACGTACGTACGTACGTACG TACG -5’

Q.109 If the double stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.

Ans.

If the double-stranded DNA has 20 percent of cytosine, the percent of adenine in the DNA would be 30%.

Explanation: As a rule no. of A= no. of T and no. of G = no. of C. Also, A+T=G+C. The bases in the two strands are paired through hydrogen bond (H-bonds) forming base pairs. Cytosine forms three H-bonds with Guanine that means if Cytosine is 20%, Guanine is also 20%. This leaves 60% for Adenine and Thymine which are paired through two H-bonds. Thus, Adenine would be 30%.

Q.110 Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine

Ans.

Nitrogenous Bases Nucleosides
Adenine, Cytosine, Thymine, Uracil Cytidine, Guanosine

Explanation: A nucleotide has three components: a nitrogenous base, a pentose sugar (ribose in case of RNA and deoxyribose in case of DNA) and a phosphate group. A nitrogenous base is linked to the pentose sugar through N-glycosidic linkage to form a nucleoside.

Q.111 How do biofertilisers enrich the fertility of the soil?

Ans.

Biofertilisers are organisms that enrich the nutrient quality of the soil. The main sources of biofertilisers are bacteria, fungi, and cyanobacteria. Biofertilisers can enrich the fertility of the soil in the following ways:

  1. Nitrogen enrichment – Bacteria like Azospirillum and Azotobacter are free-living in the soil and can fix atmospheric nitrogen thus increasing the nitrogen content of the soil. Rhizobium another nitrogen-fixing bacteria forms nodules on the plant roots and lives symbiotically. Cyanobacteria are widely distributed in aquatic and terrestrial environments many of which can fix atmospheric nitrogen, e.g. Anabaena, Nostoc, Oscillatoria, etc. In paddy fields, cyanobacteria serve as an important biofertiliser.
  2. Phosphorous enrichment – Fungus like Glomus form Mycorrhiza live symbiotically with a plant and help in absorbing phosphorus for the plant.

Q.112 Arrange the following in the decreasing order (most important first) of their importance, for the welfare of human society. Give reasons for your answer.

Biogas, Citric acid, Penicillin and Curd

Ans.

Entity Importance in society
1 Penicillin The first antibiotic and is used for the treatment of several life-threatening bacterial infections.
2 Biogas A clean, environmentally friendly, sustainable source of energy made of biological waste product. Biogas production can be carried out by unskilled people and is not expensive. It provides energy for cooking and generating electricity in the areas with limited resources.
3 Citric Acid The dominant use of citric acid is as a flavouring agent and preservative in food and beverages. Industrial-scale production of citric acid began during world war I.
4 Curd Curd has many health benefits for humans. It is a natural probiotic which keeps the microflora of the gut healthy and balanced. Curd is also a source of nutrients like calcium, vitamin-B12, etc.

Q.113 Find out the role of microbes in the following and discuss it with your teacher.
(a) Single cell protein (SCP)
(b) Soil

Ans.

(a) Single Cell Protein (SCP)

SCP refers to the dried microbial cells or total protein extracted from pure microbial cell culture (algae, bacteria, filamentous fungi, yeasts), which can be used as food supplement for humans (food grade) or animals (feed grade). SCP, a non-conventional protein source can help solve the problem of malnutrition, food and feed shortage in the developing countries. The production of ‘Single Cell Protein’ can be done using waste materials as the substrate, specifically agricultural wastes such as wood shavings, sawdust, corn cobs, etc. and culturing yeast, bacteria, algae or fungi. Spirulina algae, is a good resource as it can be mass cultivated easily and is fast growing with high nutritional content.

(b) Soil

Microorganisms in soil are important because they affect the structure and fertility of different soils. Soil microorganisms can be classified as bacteria, actinomycetes, fungi, algae, and protozoa. Each of these groups has different functions in the soil they inhabit. Some examples of microbes, which are beneficial for soil quality are as follows:

Microorganisms Species Function
Bacteria Nitrobacter Turns nitrite into nitrate, which results in the gain of oxygen and is also known as oxidation
Pseudomonas Metabolises a wide range of chemicals and fertilisers
Anabaena, Nostoc, Oscillatoria Nitrogen fixation
Azospirillum and Azotobacter Fixes atmospheric nitrogen
Algae Blue-green algae Nitrogen fixation
Fungi Glomus Absorption of phosphorus

Q.14 Find out the name of the microbes from which Cyclosporin A (an immunosuppressive drug) and Statins (blood cholesterol lowering agents) are obtained.

Ans.

Cyclosporin A An immunosuppressive drug Tolypocladium inflatum (fungus)
Statins

Lovastatin

Simvastatin

Blood cholesterol lowering agents Monascus purpureus (fungus)

Aspergillus terreus (fungus)

Q.115 Three water samples namely river water, untreated sewage water and secondary effluent discharged from a sewage treatment plant were subjected to BOD test. The samples were labeled A, B and C; but the laboratory attendant did not note which was which. The BOD values of the three samples A, B and C were recorded as 20 mg/L, 8 mg/L and 400 mg/L, respectively. Which sample of the water is most polluted? Can you assign the correct label to each assuming the river water is relatively clean?

Ans.

BOD refers to the amount of the oxygen that would be consumed if all the organic matter in one litre of water is oxidised by bacteria. The BOD test measures the rate of uptake of oxygen by micro-organisms in a sample of water and thus, indirectly, BOD is the measure of the organic matter present in the water. The greater the BOD of waste water more is its polluting potential.

Sample BOD values Water sample types
A 20 mg/L Secondary effluent This is the effluent that has been treated before disposing into the natural water bodies.
B 8 mg/L River water This sample has the least amount of organic matter. Therefore, it can be considered the river water.
C 400 mg/L Untreated sewage water This is the municipal sewage that is collected for treatment in the STP.

Q.116 Microbes can be used to decrease the use of chemical fertilisers and pesticides. Explain how this can be accomplished.

Ans.

The chemical fertilisers and pesticides used in agricultural practices these days pose several health hazards to humans and also create an imbalance in the natural ecosystem. To decrease the use of these chemicals, microbes have been employed through various methods like:

Biopesticides: Biological control of pests and diseases relies on using the natural pest-predator relationship to control diseases. Some microbes have proven to be effective biological control agents and have shown to have no impact on other useful plants or animals. For examples:

  • Trichoderma species is a fungus that is commonly found in the root ecosystem. They are effective biocontrol agents of several plant pathogens.
  • Bacillus thuringiensis is the most widely used species of bacteria for biological control of insects.
  • Baculoviruses are pathogens that attack insects and other arthropods.

Biofertilisers: They add nutrients through the natural processes of nitrogen fixation, solubilising phosphorus, and stimulating plant growth through the synthesis of growth-promoting substances. They can be applied to seed, plant surfaces, or soil. They colonise the interior of the plant and promote growth by increasing the supply or availability of primary nutrients to the host plant. For examples:

  • Azotobacter can be used with crops like wheat, maize, mustard, cotton, potato, and other vegetable crops.
  • Azospirillum inoculations are recommended mainly for sorghum, millets, maize, sugarcane, and wheat.
  • Blue-green algae fix atmospheric nitrogen and are used as inoculations for paddy crop.

Q.117 Do you think microbes can also be used as source of energy? If yes how?

Ans.

Yes, microbes can be used as a source of energy. One of the most common examples of microorganisms being used for obtaining energy is biogas.

Biogas: Methanogens are anaerobic bacteria that breakdown cellulosic material producing large amounts of methane along with carbon dioxide and hydrogen. These bacteria reside in the stomach of cattle and help the animal to digest the cellulose. Cattle dung is rich in these bacteria and is used in the production of biogas. The biogas plant consists of a concrete tank (10-15 feet deep) into which biowastes are collected and the slurry of dung is fed. A floating cover is placed over the slurry, which keeps on rising as the gas is produced in the tank due to the microbial activity. The biogas plant has an outlet, which is connected to a pipe to supply biogas to nearby houses.

Q.118 What is the key difference between primary and secondary sewage treatment?

Ans.

Primary Sewage Treatment Secondary Sewage Treatment
Mechanical, inexpensive and simple process Biological, expensive and complicated process
Involves simple filtration and sedimentation of sewage for the removal of debris Involves the use of microbes to breakdown the organic matter in the sewage

Explanation: Before being drained into water bodies like rivers and lakes, sewage needs to be treated to remove the organic matter. This is carried out in two stages:

Primary Sewage Treatment: The initial phase of sewage treatment involves physical removal of particles. These are removed in two stages;

  1. Sequential filtration for removing floating debris
  2. Sedimentation for removing grit (soil and small pebbles)

All the solids that settle form the primary sludge and the supernatant forms the effluent. The effluent from the primary settling tank is taken for secondary treatment.

Secondary sewage treatment or Biological treatment: This is also carried out in stages before the water can be returned to natural water sources.

  1. Aeration tank: The primary effluent is passed into large aeration tanks where it is constantly agitated mechanically and air is pumped into it. This allows vigorous growth of useful aerobic microbes into flocs (masses of bacteria associated with fungal filaments to form mesh-like structures). While growing, these microbes consume the major part of the organic matter in the effluent. This significantly reduces the BOD (biochemical oxygen demand) of the effluent. BOD refers to the amount of the oxygen that would be consumed if all the organic matter in one litre of water is oxidised by bacteria. The sewage water is treated till the BOD is sufficiently reduced after which the effluent is then passed into a settling tank.
  2. Settling tank: Here the bacterial ‘flocs’ are allowed to sediment. This sediment is called activated sludge. A small part of the activated sludge is pumped back into the aeration tank to serve as the inoculum. The remaining major part of the sludge is pumped into large tanks called anaerobic sludge digesters.

Anaerobic sludge digesters: Here anaerobic bacteria digests the bacteria and fungi in the sludge. The effluent from the secondary treatment plant is generally released into natural water bodies like rivers and streams.

Q.119 What is sewage? In which way can sewage be harmful to us?

Ans.

Municipal wastewater that contains human excreta and effluent from the kitchen and bathrooms is collectively called sewage. Sewage contains large amounts of organic matter and also microbes some of which can be harmful to humans and other living beings. Sewage water is a major source of water pollution. Therefore, it is important and mandatory to collect, treat and dispose of sewage responsibly.

Q.120 Name any two species of fungus, which are used in the production of the antibiotics.

Ans.

Fungus Antibiotic
Penicillium notatum Penicillin
Streptomyces griseus Streptomycin

Q.121 In which way have microbes played a major role in controlling diseases caused by harmful bacteria?

Ans.

Microbes such as fungi and bacteria produce antibiotics which are chemical substances that can kill or retard the growth of other (disease-causing) microbes. Antibiotics can be used to treat potentially life threatening diseases like pneumonia to relatively mild conditions such as acne. Antibiotics have greatly improved our ability to treat deadly diseases such as plague, whooping cough (kali khansi), diphtheria (gal ghotu) and leprosy (kusht rog), which used to kill millions of people all over the world.

Q.122 Name some traditional Indian foods made of wheat, rice and Bengal gram (or their products) which involve use of microbes.

Ans.

Wheat: Bread, kulchas and bhaturas

Rice: Dosa and idli

Bengal Gram: Dhokla and khandvi

Explanation: The microbes that ferment these batters are found naturally on urad dal which is used for making the batter hence, no inoculums are required to start the fermentation unlike in bread where yeast inoculum is used to initiate fermentation.

Q.123 In which food would you find lactic acid bacteria? Mention some of their useful applications.

Ans.

Lactic Acid Bacteria (LAB) can be found in curd. LAB converts milk into curd. Lactobacillus (LAB) is also used for commercial and industrial production of lactic acid. Casein, an important milk protein, is soluble at a neutral pH, but insoluble in acid. When milk turns sour, casein precipitates leading to the thickening of the product.

Lactose (milk sugar) + Lactobacillus → Lactic acid

This lactic acid causes casein to curdle and form the curd.

Q.124 Give examples to prove that microbes release gases during metabolism.

Ans.

Microbes produce different types of gaseous end-products during growth and metabolism. The type of gas produced depends upon the microbes and the organic substrates they utilise.

  1. Microbes found in the dough of idli, dosa or for making bread release CO2 during fermentation. The idli batter after being kept overnight becomes very fluffy with small bubbles. If the batter is mixed hard it flattens down because the entrapped air (carbon dioxide) escapes.
  2. Some microbes which grow anaerobically on cellulosic material produce a large amount of methane along with CO2 and H2. These bacteria are collectively called methanogens, and one such common bacterium is Methanobacterium. These bacteria reside in the stomach of cattle and help these animals to digest the cellulose. Cattle dung is rich in these bacteria and is used in the production of biogas, which can be used for cooking food and generating electricity.

Q.125 Bacteria cannot be seen with the naked eyes, but these can be seen with the help of a microscope. If you have to carry a sample from your home to your biology laboratory to demonstrate the presence of microbes under a microscope, which sample would you carry and why?

Ans.

I would carry some fresh homemade yogurt/ curd because ‘Lactic acid bacteria’ (LAB) for example Lactobacillus grows in milk and converts it into curd. A small amount of curd contains millions of LAB and these can be easily observed under a microscope.

Method to observe LAB under the microscope:

  1. Make a thin smear of curd on a glass slide.
  2. Stain the smear according to the procedure for the Gram stain or with methylene blue.
  3. View the stained smear at 400x to determine the characteristic features of Lactobacillus like rod-shaped cells.
  4. Observe the morphology. LABs the rod- shaped bacteria will stain blue.

Q.126 How many eggs do you think were released by the ovary of a female dog which gave birth to 6 puppies?

Ans.

Dogs are polyovulatory non-seasonal species. More than one egg is released from the ovary in each ovulation cycle. Thus, if a female dog gave birth to 6 puppies, it means that 6 eggs were released during ovulation and they all got fertilised.

Q.127 How many eggs are released by a human ovary in a month? How many eggs do you think would have been released if the mother gave birth to identical twins? Would your answer change if the twins born were fraternal?

Ans.

A single egg is released by human ovary every month by the process of ovulation.

Only a single egg is released in the ovary when the mother gives birth to identical twins. The blastomeres separate during early zygotic stage giving rise to identical twins.

When the twins born are fraternal, two eggs are released in the ovary during a single ovulation event and both are fertilised by two separate sperms leading to the formation of two zygotes.

Q.128 In our society the women are often blamed for giving birth to daughters. Can you explain why this is not correct?

Ans.

In our society, women are often blamed for giving birth to daughters. However, this is a completely wrong statement as the sex of the child depends upon the sex chromosome of the sperm that has fused with the mother’s egg giving rise to the zygote. All human beings have 23 pairs of chromosomes out of which, 22 pairs are autosomes and 23rd pair is the sex chromosome. Females have 22 pairs of autosomes and XX chromosomes as their sex chromosome. In the case of males, 22 pairs are autosomes and there are two different kinds of sex chromosomes namely X and Y. When gametes (sperms) are formed in males, some receive X sex chromosome, while others receive Y sex chromosome. Now, depending upon the sperm type (carrying either X or Y chromosome) that fuses with the ovum, the sex of the foetus is determined. Fertilisation with an X chromosome carrying sperm will result in a female child, while that with Y carrying sperm will result in a male child. Thus, it is incorrect to blame women for the gender of the child.

Q.129 What is parturition? Which hormones are involved in induction of parturition?

Ans.

Parturition is the process of delivery of the foetus (childbirth) due to vigorous contractions of the uterus at the end of nine months of pregnancy. This is induced by a complex neuroendocrine mechanism. The signals for parturition are generated from the fully developed foetus and placenta which generates mild uterine contractions. This triggers the release of hormone oxytocin from the maternal pituitary. Oxytocin acts on the uterine muscles and causes stronger uterine contractions, which in turn stimulates further secretion of oxytocin. The other hormone that is involved in parturition is relaxin which is responsible for relaxation of ligaments of the pelvic region and thus; helps in childbirth.

Q.130 What is menstrual cycle? Which hormones regulate menstrual cycle?

Ans.

A series of cyclic physiological changes that occur inside the female reproductive tract of the primates from the beginning of one menstrual period to the beginning of the next is called the menstrual cycle. In humans, this cycle consists of about 28/29 days. One ovum is released during the middle of each cycle and the endometrium of the uterus also undergoes a cyclic series of events. The major events of the menstrual cycle are as follows:

(a) Menstrual phase (Days 1-5): During days 1-5, there is a low level of female sex hormones in the body, causing the uterine lining to disintegrate and its blood vessels to rupture. A flow of blood, known as menses, passes out of the vagina during a period of menstruation.

(b) Follicular Phase (Day 6-13): There is increased production of estrogen by growing ovarian follicle which causes endometrium of uterus to thicken, and become vascular and granular. The primary follicle in the ovary grows to become a fully mature Graafian follicle. This is called the proliferative phase of the menstrual cycle. These changes in the ovary and uterus are induced by changes in the levels of pituitary and ovarian hormones. Gonadotrophins like luteinising hormone (LH) and follicle-stimulating hormone (FSH) increase gradually during the follicular phase and stimulates follicular development as well as secretion of estrogens by the growing follicles. LH and FSH attain their peak level in the middle of the cycle (14th day). The maximum level of LH during the mid-cycle induces rupture of Graafian follicle and results in ovulation at the end of follicular or proliferative phase.

(c) Ovulatory Phase (Day 15-28): This Graafian follicle after rupture turns into corpus luteum. There is increased production of progesterone hormone from the developing corpus luteum. This results in a doubling of endometrium thickness and the uterine glands mature. A thick mucoid secretion is produced and is called secretory phase of the cycle. The endometrium is ready to implantation of a fertilised ovum however in case pregnancy does not occur, the corpus luteum degenerates and the uterine lining breaks down due to low levels of sex hormones. This results in menstruation. While menstruation is going on, the anterior pituitary begins to increase its production of FSH and a new follicle begins to mature.

Cyclic menstruation is an indicator of normal reproductive phase and extends between menarche (onset of menstruation) and menopause (menstruation stops).

Gonadotrophins like Luteinizing hormone (LH), follicle stimulating hormone (FSH) and ovarian hormones like progesterone and estrogen regulate the menstrual cycle.

Q.131 Identify True/False statements. Correct each false statement to make it true.

    1. Androgens are produced by Sertoli cells. (True/False)
    2. Spermatozoa get nutrition from Sertoli cells. (True/False)
    3. Leydig cells are found in ovary. (True/False)
    4. Leydig cells synthesise androgens. (True/False)
    5. Oogenesis takes place in corpus luteum. (True/False)
    6. Menstrual cycle ceases during pregnancy. (True/False)
    7. Presence or absence of hymen is not a reliable indicator of virginity or sexual experience. (True/False)

Ans.

  1. False, androgens are not produced by Sertoli cells. Sertoli cells are found inside the seminiferous tubules. Androgen is produced by interstitial cells or Leydig cells found in the regions outside the seminiferous tubules.
  2. True
  3. False. Leydig cells are not found in ovary. Leydig cells are found in the regions outside the seminiferous tubules, called interstitial spaces.
  4. True
  5. False, oogenesis does not take place in corpus luteum. Oogenesis takes place in Graafian follicle found in the ovary.
  6. True
  7. True

Q.132 Name the functions of the following:
(a) Corpus luteum
(b) Endometrium
(c) Acrosome
(d) Sperm tail
(e) Fimbriae

Ans.

(a) Corpus luteum: Corpus luteum is the transformed and ruptured Graafian follicle after ovulation phase. During the luteal phase of the menstrual cycle, corpus luteum secretes large amounts of progesterone which is essential for the maintenance of the endometrium and making it ready for implantation of the fertilised ovum and other events of pregnancy.

(b) Endometrium: The endometrium functions as the inner lining of the uterus, preventing adhesions between the opposed walls of the myometrium. During the menstrual cycle, the endometrium grows to a thick, blood vessel-rich, glandular tissue layer. This provides optimal environment for the implantation of a blastocyst upon its arrival in the uterus. During pregnancy, the glands and blood vessels in the endometrium further increase in size and number. Vascular spaces fuse and become interconnected, forming the placenta, which supplies oxygen and nutrition to the developing embryo.

(c) Acrosome: Acrosome is a cap-like structure found at the head of a sperm that comes in contact with the ovum at the time of fertilisation and releases a hydrolytic enzyme, called hyaluronidase, that hydrolyses the outer membrane of the ovum and thus, helps in the process of fertilisation.

(d) Sperm tail: The sperm tail is made of protein fibres that contracts on the alternative sides, performing a wave-like movement. This imparts motility to the sperm and facilitates the movement of the sperm inside the female reproductive tract so that it can reach the ovum to fertilise it .

(e) Fimbriae: Fimbriae are finger-like projections found at the edges of infundibulum, which is the ovarian end of the fallopian tube). This structure helps in the collection of ovum after ovulation with the help of ciliary movement

Q.133 Draw a labelled diagram of a Graafian follicle.

Ans.

Q.134 Draw a labelled diagram of a section through ovary.

Ans.

Q.135 What is oogenesis? Give a brief account of oogenesis.

Ans.

The process of formation of a mature female gamete is called oogenesis. Oogenesis is initiated during the embryonic development stage when a couple of million gamete mother cells or oogonia are formed in each fetal ovary. These cells start dividing and enter prophase-I of the meiotic division and get temporarily arrested at that stage. They are called primary oocytes at this stage. The primary oocytes then get surrounded by a layer of granulosa cells and this structure is called primary follicle. Many of the primary follicles degenerate from birth to puberty phase. About 60,000-80,000 such primary follicles remain at the onset of puberty. The primary follicle gets surrounded by more layers of granulosa cells and a new theca. This structure is then called secondary follicle. Out of thousands of such follicles, only about 400 ever mature because a female produces only one egg per month during her reproductive years.

The secondary follicle soon transforms into a tertiary follicle with a fluid-filled cavity called antrum with the further organisation of theca layer. It is during this stage that the primary oocyte grows in size and completes its first meiotic division. It is an unequal division that results in the formation of a large haploid secondary oocyte and a tiny polar body. The secondary oocyte retains most of the nutrient-rich cytoplasm. This tertiary follicle changes into a mature Graafian follicle. The secondary oocyte forms a new membrane, called zona pellucida, surrounding it. The Graafian follicle ruptures and the secondary oocyte or ovum is released from the ovary. This process is called ovulation.

The ovarian cycle is under the control of gonadotropic hormones, follicle-stimulating hormone (FSH) and luteinising hormone (LH). It is the interplay between these two hormones that control the ovulation cycle.

Q.136 What are the major functions of male accessory ducts and glands?

Ans.

The main accessory ducts of the male reproductive system are rete testis, vasa efferentia, epididymis and vas deferens. Their major function is storage and transportation of sperms from the testis to the outside through urethra.

The male accessory glands are seminal vesicles, prostate and paired bulbourethral glands. Their combined secretion is called seminal plasma which is rich in fructose, calcium and certain enzymes. They provide nutrients to the sperm and also serve as a lubricant of the penis.

Q.137 What are the major components of seminal plasma?

Ans.

Seminal plasma is a mixture of secretions from three different glands (seminal vesicles, prostate and paired bulbourethral glands) of male reproductive systems. Prostate gland secretes a milky white alkaline fluid which enhances the sperm motility. The secretion from bulbourethral gland is mucoid in nature and has lubricating effect. The combination of secretion from these three different glands constitutes seminal plasma. This plasma is rich in nutrients like fructose, calcium and certain enzymes and is a thick, viscous fluid.

Q.138 Draw a labelled diagram of sperm.

Ans.

Q.139 Define spermiogenesis and spermiation.

Ans.

  1. Spermiogenesis: The final stage of spermatogenesis in which haploid spermatids, produced as a result of meiosis from spermatocytes, are converted into mature and motile spermatozoa or sperm is called spermiogenesis.
  2. Spermiation: The process by which embedded sperms, produced as a result of spermiogenesis, are released from the Sertoli cells into the lumen of seminiferous tubules is called spermiation.

Q.140 Name the hormones involved in regulation of spermatogenesis.

Ans.

The hormones involved in regulation of spermatogenesis are gonadotropin releasing hormone (GnRH), luteinizing hormone (LH), follicle stimulating hormone (FSH) and androgens (testosterone).

Functions of Hormones:

  1. Spermatogenesis starts at the onset of puberty due to a significant increase in the secretion of gonadotropin releasing hormone (GnRH), which is released from the hypothalamus.
  2. The increased level of GnRH results in the secretion of gonadotropin hormone namely luteinizing hormone (LH) and follicle-stimulating hormone (FSH). LH acts on Leydig cells and stimulates synthesis and secretion of androgens (testosterone).
  3. Androgens stimulate the process of spermatogenesis.
  4. FSH acts on the Sertoli cells and stimulates the secretion of factors that are also involved in the process of spermiogenesis.

Q.141 What is spermatogenesis? Briefly describe the process of spermatogenesis.

Ans.

The process of production of male gametes (sperms) in the primary male sex organ testes is called spermatogenesis. This process starts at the onset of puberty, where immature male germ cells or spermatogonia are converted into sperms. The diploid spermatogonia which are present on the inside wall of seminiferous tubules undergo mitotic division and increase their number. Out of these, some are called primary spermatocytes and they undergo meiotic division periodically. A primary spermatocyte completes the first meiotic division leading to the formation of two equal, haploid cells called secondary spermatocytes (having only 23 chromosomes). The secondary spermatocytes undergo the second meiotic division and thus produce four equal, haploid spermatids. Spermatids also have 23 chromosomes and are thus; haploid. The process of spermiogenesis further transforms these spermatids into spermatozoa (sperms) after which the sperm head gets embedded in the Sertoli cells. As the last step, they are released from the seminiferous tubules by the process called spermiation.

Q.142 Describe the structure of a seminiferous tubule.

Ans.

Seminiferous tubules are highly coiled structures found in each lobule of testes and are 1-3 in numbers. The combined length of all the tubules found in the testes is approximately 250 m. Each seminiferous tubule is lined on its inside by two types of cells namely

  • Male germ cells or spermatogonia
  • Sertoli cells

It is packed with cells undergoing spermatogenesis. The Sertoli cells not just provide the support and nourishment (nutrients) to the sperms, but also regulate the spermatogenic cells. The regions outside the seminiferous tubules are called interstitial spaces. They contain small blood vessels and interstitial or Leydig cells. Leydig cells are polyhedral in shape. They synthesise and secrete testicular hormones called androgens.

Diagrammatic sectional view of seminiferous tubule

Q.143 Write two major functions each of testis and ovary.

Ans.

Two major functions of testis:

(a) Production of sperms in the highly coiled seminiferous tubules

(b) Secretion of a male hormone called testosterone by interstitial cells

Two major functions of ovary:

(a) Production of female gamete (ovum) every month by the process of oogenesis

(b) Production and secretion of female sex hormones, estrogen and progesterone, during the ovarian cycle

Q.144 Draw a labelled diagram of female reproductive system.

Ans.

Q.145 Draw a labelled diagram of male reproductive system.

Ans.

Q.146 1. Fill in the blanks:
(a) Human reproduce . (asexually/sexually)
(b) Humans are . (oviparous/viviparous/ovoviviparous)
(c) Fertilisation is in humans. (external/internal)
(d) Male and female gametes are . (diploid/haploid)
(e) Zygote is (diploid/haploid)
(f) The process of release of ovum from a mature follicle is called .
(g) Ovulation is induced by a hormone called .
(h) The fusion of male and female gametes is called .
(i) Fertilization takes place in .
(j) Zygote divides to form which is implanted in uterus.
(k) The structure which provides vascular connection between foetus and uterus is called .

Ans.

(a) sexually

(b) viviparous

(c) internal

(d) haploid

(e) diploid

(f) ovulation

(g) luteininsing hormone

(h) fertilisation

(i) fallopian tube

(j) blastocyst

(k) placenta (umbilical cord)

Q.147 In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided?

Ans.

There are several factors responsible for motivating youngsters towards alcohol or drugs. Curiosity, need for adventure, excitement and experimentation constitute common causes, which motivate youngsters to try drugs and alcohol. Television, movies, newspapers, the internet also help to promote the perception that drugs and alcohol can solve many big problems. Other factors that are associated with rampant drug and alcohol abuse among adolescents are unstable or unsupportive family structures and peer pressure.

Preventive measures against alcohol and drug abuse are as follows:

(i) Avoid undue peer pressure – A child should not be pressurised unduly to perform beyond his/her threshold limits be it studies, sports or other activities.

(ii) Education and counselling – Educating and counselling him/ her to face problems and stresses, and to accept disappointments and failures as a part of life. Children should channelise their energy into healthy pursuits like sports, reading, music, yoga and other extracurricular activities.

(iii) Seeking help from parents and peers – Help from parents and peers should be sought immediately so that they can guide appropriately.

(iv) Looking for danger signs – Alert parents and teachers need to look for and identify the danger signs. Appropriate measures would then be required to diagnose the malady and the underlying causes.

(v) Seeking professional and medical help – Youngsters who have become drug/alcohol addicts should take help from highly qualified psychologists, psychiatrists, and attend de-addiction and rehabilitation programmes to help themselves.

Q.148 Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher.

Ans.

Drug and alcohol consumption has an addictive nature associated with a temporary feeling of well-being. With repeated use of drugs, the tolerance level of the drug receptors present in our body increases. Consequently, the receptors respond only to higher doses of drugs or alcohol leading to greater intake and addiction.

Q.149 Do you think that friends can influence one to take alcohol/drugs? If yes, how may one protect himself/herself from such an influence?

Ans.

Yes, friends can influence one to take drugs and alcohol. A person can take the following steps to protect himself/herself against drug abuse:

(a) Increase your will power to say no to alcohol and drugs. One should not experiment with alcohol for adventure and excitement.

(b) Avoid the company of friends who take drugs and alcohol.

(c) Seek help from family and peers to get rid of the habit.

(d) Take proper counselling and professional help about drug and alcohol abuse.

(e) Utilise your energy in constructive extra-curricular activities.

Q.150 List the harmful effects caused by alcohol/drug abuse.

Ans.

Addiction to alcohol/drugs is a very serious problem the present-day society is facing and is a cause of real concern.

Effects of alcohol:

On an individual: Alcohol causes short-term as well as the long-term effect on an individual.

  1. Short-term effects include Slurred speech, drowsiness, vomiting, diarrhoea, headaches, breathing difficulties, unconsciousness etc.
  2. Long-term effects include High blood pressure, stroke, liver disease, nerve damage, vitamin B1 deficiency, ulcers, malnutrition etc.

Also, it is advisable for pregnant women to avoid alcohol as it may retard the growth of the baby.

On the family: Long term consumption of alcohol by any family member can have negative effects on the family. It may lead to several domestic problems like quarrels, sexual assault, domestic violence, frustrations, insecurity, etc.

On the society: Increased on-the-job injuries and loss of productivity, rash behaviour, violence and loss of interest in social activities.

Similarly, an individual who is addicted to drugs creates problems for himself as well as for the family and society.

Effects of drugs:

On an individual: It weakens the immune system and causes cardiovascular diseases. Injected drugs can cause infections of the blood vessels and heart valves, dramatic fluctuations in appetite and increase in body temperature. Susceptibility of HIV infection is most common in these individuals as they share common needles while injecting drugs in their body.

On the family and society: A person addicted to drug creates a family as well as a social problem as he becomes frustrated, irritated, confused and may become anti-social.

The most common warning signs of drug and alcohol abuse among youth include drop in academic performance, unexplained absence from school/college, lack of interest in personal hygiene, withdrawal, isolation, depression, fatigue, aggressive and rebellious behaviour, deteriorating relationships with family and friends, loss of interest in hobbies, change in sleeping and eating habits, fluctuations in weight, appetite, etc.

Q.151 Explain what is meant by metastasis.

Ans.

The pathological process of spreading cancerous cells to the different parts of the body is called metastasis. The property of metastasis is exhibited by malignant tumours. The malignant tumours are a mass of proliferating cells called neoplastic or tumour cells. These cells grow very rapidly, invading and damaging the surrounding normal tissues. As these cells actively divide and grow, they also starve the normal cells by competing for vital nutrients. Cells sloughed from such tumours travel through blood and lymph, reach distant sites and rise to a new tumour.

[Explanation: Metastasis is a complex process and to successfully colonise a distant area in the body, the cancer cell must complete a series of steps to form a clinically detectable lesion. The most common sites of cancer metastasis are the bone, liver and lung ].

The steps of metastasis include:

Separation from the primary tumour.
Invasion through tissues around the initial lesion.
Entry into the blood vessels and lymphatic vessel.
Reaching the distant organ like lungs, liver, bone.
Formation of a new tumour along with new blood vessels feeding the tumour.

Q.152 How is a cancerous cell different from a normal cell?

Ans.

Normal cell

Cancerous cell

Normal cells show a property called contact inhibition by virtue of which contact with other cells inhibit their uncontrolled growth and they stop dividing.

Cancerous cells lack the property of contact inhibition. Therefore, they continue to divide, giving rise to masses of cells called tumors.

Normal cells undergo differentiation after attaining specific growth.

Cancerous cells do not undergo differentiation.

These cells remain confined at a particular location.

When the cancerous cells become malignant, they grow very rapidly, invading and damaging the surrounding normal tissues.

Q.153 What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person?

Ans.

AIDS is caused by the Human Immunodeficiency Virus (HIV), via sexual or blood-blood contact. After getting into the body of the person, the virus enters into macrophages where the RNA genome of the virus replicates to form viral DNA with the help of the enzyme reverse transcriptase. This viral DNA gets incorporated into the host cell’s DNA and directs the infected cells to produce virus particles. The macrophages continue to produce virus and in this way, they act as an HIV factory. HIV enters into helper T-lymphocytes (TH), replicates and produces progeny viruses. The progeny viruses released in the blood attack other helper T-lymphocytes. This repeated process leads to a progressive decrease in the number of helper T-lymphocytes in the body of the infected person, thereby decreasing the immunity of a person.

Q.154 What are the various routes by which transmission of human immunodeficiency virus takes place?

Ans.

AIDS is caused by the Human Immuno deficiency Virus (HIV), a member of a group of viruses called retrovirus, which has an envelope enclosing the RNA genome. Transmission of HIV-infection generally occurs in the following ways:

(a) Sexual contact with an infected person.

(b) Transfusion of contaminated blood and blood products.

(c) Sharing infected needles like in the case of using intravenous drug abusers.

(d) From an infected mother to her child through the placenta.

Q.155 Draw a well-labelled diagram of an antibody molecule.

Ans.

A well-labelled diagram of an antibody molecule is depicted below:

Q.156 Differentiate the following and give examples of each:
(a) Innate and acquired immunity
(b) Active and passive immunity

Ans.

(a)

Innate immunity Acquired immunity
Innate immunity is a non-specific type of defence that is present at the time of birth. Acquired immunity is pathogen-specific. It is characterised by memory.
It is inherited from parents. It is acquired after the birth when the host encounters a pathogen.
It functions by providing various barriers such as

(i) Physical barriers (ii) Physiological barriers (iii) Cellular barriers and (iv) cytokine barriers against the entry of foreign infectious agents.

It functions by producing primary and secondary immune responses, which are mediated by B−lymphocytes and

T-lymphocytes.

It does not have a specific memory. It is characterised by an immunological memory upon encounter with the antigen.

(b)

Active immunity Passive immunity
It is a type of acquired immunity wherein the body produces its own antibodies against living or dead microbes or other proteins. It is a type of acquired immunity where readymade antibodies are administered directly to protect the body against foreign agents.
It is slow and takes time in generating antibodies and giving responses. It is fast and provides immediate relief.
For example: Injecting the microbes deliberately during immunisation or infectious organisms gaining access into the body during natural infection induces active immunity. Transfer of antibodies from the mother’s milk to the infant through yellowish fluid colostrums during the initial days of lactation is an example of passive immunity.

Q.157 The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its full form:
(a) MALT
(b) CMI
(c) AIDS
(d) NACO
(e) HIV

Ans.

(a) MALT- Mucosa-Associated Lymphoid Tissue

(b) CMI- Cell-Mediated Immunity

(c) AIDS- Acquired Immuno Deficiency Syndrome

(d) NACO- National AIDS Control Organisation

(e) HIV- Human Immuno Deficiency virus

Q.158 Name the primary and secondary lymphoid organs.

Ans.

(a) Primary lymphoid organs include the bone marrow and the thymus.

[Explanation: In these primary lymphoid organs, immature lymphocytes differentiate into antigen-sensitive lymphocytes.]

(b) Secondary lymphoid organs are the ‘Peyer’s patches of small intestine’, spleen, lymph nodes, tonsils, and appendix.

[Explanation: The secondary lymphoid organs provide the sites for interaction of lymphocytes with the antigen, which then proliferate to become effector cells.]

Q.159 Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.

Ans.

A ‘suitable gene’ refers to a specific DNA segment which can be injected into the body of the host to produce specific proteins or antibodies. These antibodies can kill specific disease-causing organism in the host and provide immunity.

[Explanation: DNA introduced into the cells remains active for a long period and this therapy provides a long term protection from the disease. This powerful strategy is also used to reestablish the normal equilibrium and overcome a diseased condition in host.]

Q.160 What measures would you take to prevent water-borne diseases?

Ans.

Water-borne diseases such as amoebiasis, ascariasis, cholera, typhoid, hepatitis B are spread by drinking contaminated water. These water-borne diseases can be prevented by consumption of clean drinking water, food, vegetables, fruits, etc. Public hygiene measures like proper disposal of waste and excreta, periodic cleaning and disinfection of water reservoirs, pools, cesspools and tanks need to be done.

Q.161 How does the transmission of each of the following diseases take place?
(a) Amoebiasis
(b) Malaria
(c) Ascariasis
(d) Pneumonia

Ans.

Sl. No Disease Causative

organism

Mode of transmission
a. Amoebiasis Entamoeba histolytica It is a vector-borne disease. The housefly is the vector which acts as a mechanical carrier and transmits the parasite.

The infection spreads through the drinking of contaminated water and food.

b. Malaria Different

species of Plasmodium

It is a vector-borne disease that spreads by biting of infected female Anopheles mosquito.
c. Ascariasis Ascaris lumbricoides A healthy person acquires this infection through contaminated water and food.
d. Pneumonia Streptococcus pneumoniae and Haemophilus influenzae A healthy person acquires this infection by inhaling the droplets/aerosols released by an infected person or by sharing glasses and utensils with an infected person.

Q.162 In which way has the study of biology helped us to control infectious diseases?

Ans.

Numerous advancements made in biological science have helped us to deal with many infectious diseases efficiently. Study of the biology of many disease-causing organisms has helped us to understand the lifecycle and disease-causing properties of the causative agent. This has helped in the production of new and safer vaccines. Through vaccines and immunisation programmes, many infectious diseases like polio, diphtheria, pneumonia and tetanus have been controlled to a large extent. Discovery of antibiotics and various other drugs has also enabled us to effectively treat infectious diseases.

Q.163 What are the various public health measures, which you would suggest as safeguard against infectious diseases?

Ans.

Public health measures are very important for the prevention and control of various infectious diseases. These measures help to safeguard against infectious diseases. Some of these measures are:

a. Maintenance of personal and public hygiene: It is very important for the prevention and control of many infectious diseases. Personal hygiene includes keeping the body clean, consumption of clean drinking water, food, vegetables, fruits, etc. and public hygiene includes proper disposal of waste and excreta, periodic cleaning and disinfection of water reservoirs, pools, cesspools and tanks. These measures are particularly essential for water-borne diseases such as typhoid, amoebiasis and ascariasis.

b. Prevention of air-borne diseases: In cases of air-borne diseases such as pneumonia and the common cold, in addition to the above measures, close contact with the infected persons or their belongings should be avoided.

c. Prevention of vector-borne disease: For diseases such as malaria and filariasis that are transmitted through insect vectors, the most important measure is to control or eliminate the vectors and their breeding places. This can be achieved by

(i) avoiding stagnation of water in and around residential areas

(ii) regular cleaning of household coolers

(iii) use of mosquito nets

(iv) introducing fish like Gambusia in ponds that feed on mosquito larvae

(v) spraying of insecticides in ditches, drainage areas and swamps, etc.

(vi) doors and windows should have wire mesh to prevent the entry of mosquitoes.

d. Vaccination and Immunisation: In this, an antigenic protein of pathogen or inactivated/weakened pathogen (vaccine) is introduced into the body to generate antibodies that neutralise the pathogenic agents during actual infection. A large number of infectious diseases like polio, diphtheria, pneumonia and tetanus have been controlled to a large extent by the use of vaccines.

Q.164 Using various resources such as your school library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal, say horse.

Ans.

In the evolutionary history of the horse, an overall evolutionary trend in the lineage is clearly visible. During the phylogenetic history of horse or Equus, the following points are distinctly noticeable:

  1. Increased overall size along with an increase in the length of feet and legs.
  2. Increased grinding surface of the molar teeth.
  3. Reduced number of toe.
  4. Strengthening of back.
  5. Development of brain and other sensory organs

Evolutionary History: The history of horse begins with Hyracotherium (also known as Eohippus). They were dog-sized mammals with a small head and small, low-crowned molars with cusps. The feet, with 4 toes on each front foot and 3 toes on each hind foot, were padded. They were present in the Eocene era and were adapted to the forest-like environment present at that time. The small size allowed them to hide easily among the trees for protection, and the low-crowned teeth were appropriate for browsing on leaves.

With the passage of time, grasslands replaced forests, thus putting selective pressure on the Eohippus. They were required to develop strength, intelligence, speed and durable grinding teeth. This resulted in their increased size to provide more strength, a larger skull for a larger brain, elongated legs ending in hooves for greater speed to escape enemies, and the durable grinding teeth to feed efficiently on grasses. These characters slowly evolved in Miohippus, Merychippus and Pliohippus with passage of time from Eocene to Pliocene era.

The modern-day Equus came into existence sometime in the Pleistocene era. They have one toe in each foot. The incisors for cutting and molars for grinding are also very well developed.

Q.165 Can we call human evolution as adaptive radiation?

Ans.

No, human evolution cannot be called as adaptive radiation. Adaptive radiation is the rapid development of many new species from a single ancestral species, which then spread out and become adapted to various conditions. Human evolution took place slowly over millions of years and is an example of anagenesis where change occurs very slowly.

Q.166 Describe one example of adaptive radiation.

Ans.

Adaptive radiation is the rapid development of many new species from a single ancestral species, which then spread out and become adapted to various ways of life. One of the best examples of adaptive radiation has been Galapagos finches. During his HMS Beagle voyage, Darwin had observed an amazing diversity of small black birds (Darwin’s finches) on the same island. According to him, all these evolved on the island itself from one single species. The original birds were seed-eating creatures and then evolved forms with altered beaks, enabling them to become insectivorous and vegetarian finches. A small number of mainland finches arrived at one of the Galapagos islands. Genetic drift and natural selection process began acting on this group. This group then migrated to two more islands where there was no more gene flow between these groups and each was again subjected to genetic drift and different kinds of selection pressures. As they migrated back to the original island, they did not interbreed and behaved as independent species. They became adapted to the new environment and thus, evolved as separate species.

Q.167 List 10 modern-day animals and using the internet resources link it to a corresponding ancient fossil. Name both.

Ans.

List of 10 modern-day animals along with corresponding ancient fossil:

S. No. Modern-day animal Ancient fossil
1 Dog Leptocyon
2 Horse Eohippus
3 Elephant Mastodons
4 Crocodiles Protosuchus
5 Birds Archaeopteryx
6 Camel Protylopus
7 Crocodiles Sarcosuchus
8 Fish Ostracoderms
9 Whale Protocetus
10 Giraffe Palaeotragus

Q.168 Find out through internet and popular science articles whether animals other than man have self-consciousness.

Ans.

Self-consciousness means having conscious knowledge of one’s own character, feelings, motives and desires – and imagining how others might perceive us. It extends right up to having self-conscious emotions like pride or shame. It is a measure of intelligence – and most living species on the planet do not possess it. Of the hundreds of animals tested (by mirror test) so far, only 10 animals have been proven to have any measurable degree of self-awareness. They are Humans, Orangutans, Chimpanzees, Gorillas, Bottlenose Dolphins, Elephants, Orcas, Bonobos, Rhesus Macaques and European Magpies.

Q.169 Try to trace the various components of human evolution (hint: brain size and function, skeletal structure, dietary preference, etc.)

Ans.

Human evolution has been a lengthy process of change by which human originated from ape-like ancestors. Scientific evidence shows that the physical and behavioral traits shared by all people originated from ape-like ancestors and evolved over a period of approximately six million years. The following chart depicts some components of human evolution:

S.No. Name Brain Size Posture Skeletal Structure Dietary Preference Features
1 Dryopithecus africans Walked similar to gorillas and chimpanzees in knuckles Legs and arms were of same size. Soft fruits and leaves Had large canines.
2 Ramapithecus Semi-erect (more man like) semi-erect posture Herbivorous, seed eaters Small canines with well-developed and large molars.
3 Australopithecines ~440 cc brain Walked upright with fully erect posture

(1 m)

Pelvis resembled a modern human and a tibia/femur design supporting bipedal locomotion Herbivorous (leaves, fruits, wood and bark) Greater reasoning skills and more control of motor functions. Knew hunting with stones.
4 Homo habilis

(1.6-2.5 mya)

650-800 cc brain Fully erect posture with 1.5 m height They had a smaller snout and bigger nose, and an elevated forehead different from the earlier ancestors Carnivorous Had rational thought and problem solving capacity. Canines were small. They were the first to make tools.
5 Homo erectus 900 cc Fully erect posture with 1.5-1.8 m height. Fully erect posture Omnivorous They used stone and bone tools for hunting and gaming.
6 Neanderthal man 1400 cc Fully erect posture with 1.5-1.66 m height larger bones and more heavily muscled than most modern humans. Omnivorous Cave dwellers, used hides to protect their body and buried their dead.
7 Homo sapiens fossilis 1650 cc Fully erect posture with 1.8 m height Erect posture Omnivorous Strong jaws with close teeth. Cave dwellers; made painting and carvings in the caves. First modern man.
8 Home sapiens sapiens 1200-1600 cc Fully erect posture with 1.5-1.8 m height Erect posture Omnivorous Modern living humans with high levels of intelligence. Well developed art, culture, language and speech.

Q.170 Attempt giving a clear definition of the term species.

Ans.

Species can be defined as a group of the reproductively isolated population that inter-breed to produce fertile offspring and share phenotypic similarities.

Q.171 Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution.

Ans.

Fossils are preserved remains or traces of animals, plants or other organisms that existed a long time ago in history. They give us very important clues about the life forms that existed millions of years ago. Also, a lot has been understood in terms of origin and evolution of various groups of animals based on a study of different fossils found at different locations across the world. Few examples :

Dinosaur fossils have been known about for millennia. The Chinese considered them to be dragon bones, while Europeans believed them to be the remains of giants and other creatures killed by the Great Flood. The first dinosaur species to be identified and named was Iguanodon, discovered in 1822 by the English geologist Gideon Mantell, who recognised similarities between the fossils and the bones of modern iguanas.

  1. The discovery of a rare human skull in October 2013, sparked an evolution controversy. Researchers have discovered the fossilised skull of an early human relative in Dmanisi, Georgia. It is said to be the most complete skull ever of the early Homo genus. They say it could represent a single evolving Homo erectus lineage that came out of Africa and spread into Europe and Asia — a conclusion that is still controversial.
  2. Archaeopteryx fossil has been a classic textbook example of a species in evolutionary transition, displaying features that are a part bird, part reptile. However, scientists have reclassified it based on a newly discovered fossil of a two-legged feathered creature in China as a feathered dinosaur, one of the many that were fluttering around in the Jurassic period more than 150 million years ago.

Q.172 Explain antibiotic resistance observed in bacteria in light of Darwinian selection theory.

Ans.

According to Darwinian selection theory that the members of a population who have inheritable variations, each generation produces many more offsprings than can possibly survive and some individuals have adaptive characteristics that enable them to survive and reproduce better than other individuals. This resulted in an increasing proportion of individuals to have adaptive characteristics in succeeding generations which in turn results in a population adapted to that particular environment. The phenomenon of antibiotic resistance observed in bacteria can be very well explained in terms of Darwinian selection theory. In a population of bacteria, some bacteria already have inheritable variations in the gene responsible for resistance towards a specific antibiotic. When such a mixed population of bacteria is exposed to that specific antibiotic, those who are sensitive to it die but those with the genetic variation for antibiotic resistance, survive in the presence of that antibiotic. This antibiotic resistance trait is passed on to the next generation. When the next generation bacteria are also exposed to the antibiotic the bacteria which have inherited the trait are able to survive and those who may have and Slowly, the population of such bacteria increases and the entire population, over the time, becomes resistant to that particular antibiotic.

Q.173 Discuss briefly the following:
(a) Greenhouse gases
(b) Catalytic converter
(c) Ultraviolet B

Ans.

(a) Greenhouse gases: The major greenhouse gases are: water vapour, which causes about 36–70%, carbon dioxide (CO2) which causes 9–26%, methane (CH4) which causes 4–9%, and ozone (O3) which causes 3–7% of the greenhouse effect. Clouds also affect the radiation balance in a way similar way to greenhouse gases. The greenhouse effect is a naturally occurring phenomenon which keeps the earth surface and its atmosphere warm. Without the greenhouse effect, the average temperature of the earth’s surface would be -18°C as opposed to the habitable average of 15°C. This greenhouse effect is caused by a blanket of these greenhouse gases that form the earth’s atmosphere. The solar radiation that falls on the earth’s surface causes it to heat up. The earth’s surface re-emits the heat in the form of infrared radiations which are absorbed by the greenhouse gases and radiate the heat back on the earth’s surface.

(b) Catalytic converter: Catalytic converter is a device that is fitted into the automobiles for reducing the emission of toxic gases caused due to burning of fossil fuels. In the catalytic converters, metals like rhodium and platinum-palladium act as a catalyst to convert the poisonous gases to harmless ones. For example, unburnt hydrocarbons are converted into carbon dioxide and water, carbon monoxide is converted into carbon dioxide, and nitric oxide is converted into nitrogen gas.

(c) Ultraviolet B: Ultraviolet B or UV-B is electromagnetic radiation which is part of the invisible spectrum of light. UV-B is harmful radiation that can cause the following damages:

1 Mutations in DNA that can lead to skin cancer
2 Skin ageing
3 Skin darkening
4 Inflammation of cornea called snow-blindness cataract
5 Permanent damage to the cornea

Q.174 What initiatives were taken for reducing vehicular air pollution in Delhi? Has air quality improved in Delhi?

Ans.

In 1990, Delhi ranked as the 4th most polluted city in the world. Govt. of India decided to curb and control air pollution by taking the following measures:

  1. Buses were converted to CNG. Government made it mandatory for new light commercial vehicles to run on CNG.
  2. Restricted commercial vehicles from entering the city during peak hours.
  3. Enforced phasing out of old vehicles.
  4. Enforced use of unleaded petrol.
  5. Enforced use of low-sulphur petrol and diesel.
  6. Use of catalytic converters in vehicles.
  7. Enforced application of stringent pollution level norms for vehicles.

The above measures did improve the air quality of Delhi and it was shown that by 2005 levels of noxious gases like CO2 and SO2 had reduced. Today, Delhi has more than four million registered vehicles, the highest vehicular population in the country. Currently, the city adds over 1,000 new personal vehicles each day on its roads. The latest estimates show that the respirable suspended particulate matter (RSPM) since 2005 has increased and stands at 3 times more than the permissible limits. Persistent efforts, new methods and regulations are the need of the hour.

Q.175 Discuss briefly the following:
(a) Radioactive wastes
(b) Defunct ships and e-wastes
(c) Municipal solid wastes

Ans.

(a) Radioactive wastes: Any application of nuclear technology (such as energy generation, medicine, and research) generates radioactive wastes. These wastes remain radioactive for a long period of time and radiate gamma rays. These gamma rays are extremely harmful to flora, fauna, and the environment. Genetic mutations (causing limb deformities and other developmental disorders) are a common repercussion of exposure to radiations, while prolonged exposure could also be lethal. Radioactive waste is regulated by government agencies around the world. The radioactive waste needs to be isolated and must be kept confined for a sufficiently long period of time for the radiation intensity to come down to below hazard limit.

(b) Defunct ships and e-wastes: Ships, like any other product, have a finite life. At the end of their life, they need to be dismantled as it would be dangerous to keep on using them for the transport of people or goods. Apart from steel, that could be recycled, these defunct ships also contain hazardous materials such as asbestos, electronic wastes and waste oils. These materials cannot be recycled and if not disposed of safely. These materials pose a serious risk of contaminating seawater and endangering marine life. Dealing with materials such as, asbestos and waste oil also pose health hazards (lung and skin diseases) for the workers who are involved in the dismantling of these defunct ships. E‑wastes or e-scrap or electronic waste is a term that is used for discarded electrical or electronic devices. Improper processing of e-waste poses serious health and pollution risks. E-waste may contain contaminants such as lead, cadmium, beryllium, or brominated flame retardants. Recycling and disposal of e-waste are done either by landfilling or incarcerating. This process may involve a significant risk of exposing workers to hazardous chemicals along with leaking heavy metals.

(c) Municipal solid wastes: Municipal solid wastes are the wastes that humans generate in their daily lives. These are the things that the human population discards in the trash of the house or community. The composition of the solid waste is country-specific. For example, in India paper (or newspaper), glass bottles, and metal items are generally sold while in developed countries, one is required to put the waste in specified community bins. In general, solid waste could be categorised as follows –

  • Biodegradable: food and kitchen waste, green waste, paper (can be recycled)
  • Recyclable: paper, glass, bottles, cans, metals, certain plastics, fabrics, clothes, batteries etc.
  • Electrical and electronic waste: electrical appliances, TVs, computers etc.
  • Composite wastes: waste clothing, tetra packs, waste plastics such as toys
  • Inert waste: construction and demolition waste, dirt, rocks, debris
  • Hazardous waste including most paints, chemicals, light bulbs, fluorescent tubes, spray cans, fertilizer and containers
  • Toxic waste including pesticide, herbicides, fungicides
  • Medical waste

Q.176 What measures, as an individual, would you take to reduce environmental pollution?

Ans.

Some of the measures for reducing air pollution are:

  1. Reduce the consumption of fossil fuels by using public transport and by sharing vehicles
  2. Use catalytic converters in vehicles
  3. Regular pollution check of automobiles
  4. Use eco-friendly fuel like CNG and biofuel
  5. Plant trees to increase the green cover
  6. Light Diwali crackers sparingly

Some of the measures for reducing noise pollution are:

  1. Limit the use of horns on roads
  2. Light Diwali crackers sparingly
  3. Avoid misuse of loudspeakers

Some of the measures for reducing water pollution are:

  1. Do not throw oil, chemicals, medicines and pesticides in the drain.
  2. Do not spill diesel, petrol and other mineral oils.
  3. Use soap for cleaning and bathing judiciously.
  4. Encourage the use of recycled water for gardening, car wash, and in the toilet.

Some of the measures for reducing solid waste are:

  1. Composting of biodegradable kitchen waste
  2. Recycling and reuse of plastic and paper
  3. Responsible disposal of e-waste

Q.177 Discuss the role of women and communities in protection and conservation of forests.

Ans.

Co-existence with nature and respect for the environment is engrained in our cultural roots. Though the need for urbanisation and new technologies has caused much destruction, many communities have relentlessly worked in conserving their habitats.

Case 1: As long back as 1731, the Bishnoi community had protested cutting down of trees ordered by the king of Jodhpur. Amrita Devi, her three daughters and hundreds of Bishnoi women lost their lives because they embraced the trees and refused to let go. The widespread protest of the people led the king to give up the idea of cutting the trees for the construction of his palace.

Case 2: Chipko movement was started in the Garwhal region in 1974. Here too women hugged the trees preventing them from being cut by the timber contractors.

Q.178 Why does ozone hole form over Antarctica? How will enhanced ultraviolet radiation affect us?

Ans.

The ozone hole is more prominent in the region of Antarctica due to the presence of more concentration of chlorine in the atmosphere. One of the main sources of chlorine is chlorofluorocarbons (CFCs) which were widely used in the refrigerators as refrigerants. These CFCs can move from the troposphere to stratosphere. In the stratosphere, by the action of UV rays, CFCs release chlorine ions. These chlorine ions convert ozone molecules into oxygen gas. Each chlorine ion has the potential of destroying almost 10,000 ozone molecules and thus, causes ozone depletion. Ozone hole formation results in an increased amount of UV-B rays to the earth’s surface. UV- B rays can damage DNA and results in the ageing of the skin. It also causes skin cancer and also darkens the skin. The increased level of UV-B rays can cause corneal cataract in human beings.

Q.179 Write critical notes on the following:

    1. Eutrophication
    2. Biological magnification
    3. Ground water depletion and ways for its replenishment

Ans.

a. Eutrophication

Eutrophication is the enrichment of an ecosystem with chemical nutrients, typically compounds containing nitrogen, phosphorus, or both. Eutrophication can be a natural process in lakes, occurring as they age through geological time. Natural eutrophication encourages the growth of various types of flora in the lake which leads to deposition of organic matter and silt on the lake bottom finally converting the lake into the land. This type of natural ageing may span thousands of years.

Human activities can accelerate the rate at which nutrients enter ecosystems, in turn, accelerating the ageing process of lakes. This phenomenon is called ‘Cultural or Accelerated Eutrophication’. Agriculture, industrial and sewage waste and other human-related activities increase the flux of both inorganic nutrients and organic substances into terrestrial, aquatic, and coastal marine ecosystems. Contaminants like nitrates and phosphates overstimulate the growth of algae causing algal bloom and reducing the dissolved oxygen content of the water, which in turn causes other life forms to perish.

b. Biological magnification

Biological magnification (also called biomagnification) is a process where the concentration of a contaminant increases as one moves up the trophic levels in a food chain. Biomagnification happens when pesticides or heavy metals find their way into rivers and lakes as pollutants, they get accumulated in planktons which in turn are eaten by aquatic animals like fish which are eaten by higher-order predators like birds, animals and humans. The substances become concentrated in tissues or internal organs as they move up the chain because they cannot be excreted/metabolised.

Example of biomagnification of DDT:

(C) Groundwater depletion and ways for its replacement

Groundwater is the largest source of usable, fresh water in the world. In many parts of the world, including India, domestic, agricultural, and industrial water needs are met by using the groundwater. Groundwater depletion is primarily caused by sustained groundwater pumping, overuse of surface water from ponds and lakes (which is the source for replenishment of groundwater), deforestation due to which rainfall and water seepage are affected. Some of the negative effects of groundwater depletion are as follows:

  • Lowering of the water table.
  • The increased cost of pumping water because of the lowered water table.
  • Reduced surface water supplies because groundwater and surface water are connected. When groundwater is overused, the lakes, streams, and rivers connected to groundwater also have diminished supply.
  • Land subsidence caused by soil collapse when there is a loss of support below the ground.
  • Water quality degrades. Excessive pumping in coastal areas can cause saltwater to move inland and upward, resulting in saltwater contamination of the water supply.

Ways to replace groundwater:

  • Judicial use of groundwater and surface water
  • Rainwater harvesting
  • Afforestation

Q.180 Match the items given in column A and B:

Column A Column B
(a) Catalytic converter (i) Particulate matter
(b) Electrostatic precipitator (ii) Carbon monoxide and nitrogen oxides
(c) Earmuffs (iii) High noise level
(d) Landfills (iv) Solid wastes

Ans.

Column A Column B
(a) Catalytic converter (ii) Carbon monoxide and nitrogen oxides
(b) Electrostatic precipitator (i) Particulate matter
(c) Earmuffs (iii) High noise level
(d) Landfills (iv) Solid wastes

Q.181 Discuss the causes and effects of global warming. What measures need to be taken to control global warming?

Ans.

In the recent times, the levels of greenhouse gases such as CO2, methane, tropospheric ozone, CFCs and nitrous oxide have increased due to which the earth’s temperature is on the rise leading to global warming.

Causes of global warming are:

  • Increased human activity since the industrial revolution has led to an increase in the number of greenhouse gases released in the atmosphere. According to a study in 2007, the concentrations of CO2 and methane have increased by 36% and 148% respectively since 1750.
  • Burning of fossil fuels has produced about three-quarters of the increase in CO2 over the past decades.
  • Changes in land-use, particularly deforestation has also contributed to global warming.

Effects of global warming are:

As compared to the last century the earth’s temperature has increased by 0.6 °C.

Increased temperature has caused the melting of Himalayan snowcaps and Polar ice caps.

Increased melting of snow has resulted in increased sea levels inundating many coastal areas.

Rainfall patterns have become erratic.

Measures to control global warming:

  1. Reduce the use of fossil fuels.
  2. Improve the efficiency of energy usage.
  3. Reduce deforestation.
  4. Plant more trees.
  5. Curb the rate of growth of the human population.
  6. Reduce the emission of greenhouse gases by checking air pollution.

Q.182 List all the wastes that you generate at home, school or during your trips to other places, could you very easily reduce? Which would be difficult or rather impossible to reduce?

Ans.

Waste generated at home Plastic bags, papers, glass bottles, empty batteries, kitchen waste, domestic sewage, etc.
Waste generated at school Waste paper, plastics, sewage, food wrappers, fruit peels, etc.
Waste generated during trips Paper plates, plastic spoons and forks, paper napkins, fruit peels and vegetable peels, disposable cups, etc.

All these wastes can be categorised into recyclable, biodegradable and non-recyclable waste. We should segregate and dispose of our waste responsibly whenever possible according to these categories.

Waste generated can be minimised by judicious use of the objects listed in the table.

  1. Plastic bags can be replaced with reusable materials like jute and cloth bags.
  2. Paper can be conserved by avoiding unnecessary printing, optimal usage, using recycled paper.
  3. Domestic sewage can be reduced by optimising the use of water while bathing, cooking, cleaning and avoiding any leaks at home.

Some of the waste which would be difficult or impossible for us to reduce would include waste generated by large manufacturing units, factories, hospital waste etc because it requires special waste management techniques to manage wastes generated from these facilities.

Q.183 What are the various constituents of domestic sewage? Discuss the effects of sewage discharge on a river.

Ans.

Domestic sewage is constituted of waste that originates from kitchen, toilets, bathrooms, laundry and other cleaning activities that flow into the drains. Following are the most important constituents of domestic sewage:

  • Suspended solids like sand, silt and clay.
  • Colloidal material like faecal matter, bacteria, cloth, paper.
  • Dissolved materials like nitrate, phosphate, calcium, ammonia, house-hold chemicals like pesticides, disinfectants and soaps (e.g. sodium dodecyl sulphate).

Effect of sewage discharge on a river: Sewage discharge into rivers not only hazardous to human health but can also disrupt the river ecosystem. The following points illustrate the ill-effects of sewage discharge in the river:

  1. Micro-organisms consume a lot of dissolved oxygen during the degradation of organic waste. This leads to a sharp decline in dissolved oxygen (or increase in Biological Oxygen Demand also called BOD) causing mortality of fish and other aquatic creatures.
  2. Nutrient availability in water increases causing an overgrowth of planktonic algae which leads to the phenomenon called ‘Algal Bloom’. Algal bloom affects water quality and causes fish mortality. Some algae can be toxic to humans too.
  3. Sewage can increase the turbidity of water adversely affecting aquatic plant growth due to reduced light penetration in water.
  4. Sewage can also introduce heavy metals and other toxic substances like chemicals and pesticides. It can accumulate in the flora and fauna which can cause their mortality or have long term toxic effects.
  5. Microbial pathogens can get introduced into the rivers and cause disease outbreaks and other health problems.

Q.184 Distinguish between
(a) Grazing food chain and detritus food chain
(b) Production and decomposition
(c) Upright and inverted pyramid
(d) Food chain and Food web
(e) Litter and detritus
(f) Primary and secondary productivity

Ans.

(a) Grazing food chain and detritus food chain

Grazing food chain Detritus food chain
1. The grazing food chain begins with a plant (autotroph). The first trophic level of the chain is occupied by an autotroph such as a plant. All other animals (heterotrophs) depend on plants for their food needs. 1. Detritus food chain begins with a decomposer or detritivores e.g earthworms, bacteria and fungi.
2. In a simple grazing food chain, the producer is eaten up by primary consumer which in turn is consumed by the secondary consumer. Energy flow occurs at each level. 2. Decomposers secrete digestive enzymes that breakdown dead and waste material into simple, inorganic material which is finally absorbed by them.
3. Sun is the source of energy. 3. Decomposers derive energy from dead, decaying organic matter.
4. Grazing food chain forms the major energy flow channels on the land systems. 4. Detritus food chain forms the major energy flow channels in the aquatic systems.

(b) Production and decomposition

Production Decomposition
1. The process of preparing organic food by the producers of the ecosystem using the energy from the sun is called production. 1. The process of breaking down of complex organic biomass of dead plants and animals into simpler inorganic form is called decomposition.
2. Producers are responsible for production. 2. Decomposers are responsible for decomposition.
3. Sunlight is a must for production. 3. Sunlight is not necessary for decomposition.
4. Energy from the atmosphere is trapped in the living system during the process of production. 4. Energy from the living system is released back into the atmosphere during the process of decomposition.

(c) The upright and inverted pyramid

Upright pyramid Inverted pyramid
1. The food chain where the number or the biomass of the producers is more as compared to consumers of successively higher levels results in an upright pyramid. 1. The food chain where the number or the biomass of the producers is less as compared to consumers of successively higher levels results in an inverted pyramid.
2. Pyramid of energy is always upright pyramid. 2. Pyramid of biomass can be either upright or inverted.

(d) Food chain and Food web

Food Chain Food Web
1. A food chain is a linear sequence of species starting from a producer to consumer to decomposer depicting the nature of the dependence of each of these on the previous level. 1. Food web is an interlinked sequence of many separate food chains which are dependent on each other.
2. Food chains are straight and linear. 2. Food web is a complex network and is never linear.
3. Consumers in the food chain depend upon a single species for their food. 3. Consumers are dependent upon many species for their food.

(e) Litter and detritus

Litter Detritus
1. Litter is all kind of waste that is generated above the ground and has been disposed of inappropriately in a location without consent. 1. Detritus is remains of the dead plant such as leaves, bark, flowers and dead animals, including faecal material.
2. It is the result of human action and can be biodegradable or non-biodegradable. 3. It is the raw material for decomposition and is biodegradable.

(f) Primary and secondary productivity

Primary productivity Secondary productivity
1. Primary productivity is the rate at which solar energy is captured by producers for the synthesis of organic matter per unit area over a period of time. It is expressed in terms of (kcal m-2) yr-1 1. Secondary productivity is defined as the rate of formation of new organic matter by consumers over a period of time.
2. It results from the conversion of organic matter from inorganic matter during this process. 2. It results from the conversion of organic matter of one level into an organic matter of the next level of the food chain.

Q.185 Outline salient features of carbon cycling in an ecosystem.

Ans.

Carbon Cycle

The reservoir of Carbon: 71% of the total quantity of global carbon is dissolved in oceans and it is this oceanic reservoir of carbon that controls the amount of carbon dioxide in the atmosphere. At any given time, the atmosphere contains only 1% of the total global carbon. Other reservoirs of carbon are fossil fuels.

Recycling: Carbon cycling occurs through atmosphere, ocean and through the living and dead organisms. According to an estimate, 4 X 103 kgs of carbon is fixed in the biosphere through photosynthesis annually. Carbon constitutes 49% dry weight of organisms. A good amount of carbon returns to the atmosphere as CO2 through respiratory activities of the producers and consumers of the ecosystem. Decomposers also play an important role in the recycling of carbon through the process of decomposition. Some amount of carbon is lost to sediments and removed from circulation. Burning of wood, forest fire and combustion of organic matter, fossil fuel, volcanic activity are some more ways by which CO2 is released in the atmosphere.

To put it more precisely, carbon recycles in the ecosystem in the following ways:

  1. Carbon moves from the atmosphere to plants by the process of photosynthesis.
  2. Carbon moves from plants to animals through the food chain.
  3. Carbon moves from plants and animals to the ground through the process of decomposition.
  4. Carbon moves back to the atmosphere from plant and animals by the process of respiration.
  5. Carbon moves from fossil fuels to the atmosphere each time these fuels are burnt.
  6. Carbon moves to and from water bodies.

Q.186 Write important features of a sedimentary cycle in an ecosystem.

Ans.

The sedimentary cycle is the cycling of nutrients, whose reservoir is located in Earth’s crust, through various components of an ecosystem. Sulphur and phosphorus cycles are examples of sedimentary cycles. They are found in the earth crust and their release in the ecosystem is a very slow process. It is when the rocks weather, minute amounts of these minerals are dissolved in soil solutions and are absorbed by the roots of plants. Herbivores and other consumers obtain these from plants and during the process of decomposition, they are released back in the soil. Some important features of such sedimentary cycles are as follows:

  • The slow movement of nutrients across various levels of the food chain.
  • Involvement of very minute amounts of nutrients.
  • No gaseous phase is involved in the sedimentary cycle.
  • The atmospheric contribution is minimal.

Q.187 Give an account of energy flow in an ecosystem.

Ans.

The flow of energy in an ecosystem follows the two laws of thermodynamics. The first law says that energy cannot be created or destroyed and the second law says that when energy is transformed from one form to another, there is always some loss of energy as heat. Ecosystems need a constant input of energy from an external source. Sun is the ultimate source of energy for our planet.

Energy Flow:

Energy flows through an ecosystem from producers to consumers constituting a food chain. Producers or autotrophs capture solar energy. Of the incident solar radiations, about 50% of them are photosynthetically active radiation (PAR). Out of this, only about 2-10% of PAR is captured by photosynthetic plants and microorganisms to produce food from simple inorganic material by the process of photosynthesis. They are called producers. These producers are consumed by consumers (animals that are dependent on others for energy source) thus, passing the captured energy to the next level. The consumers that feed on the herbivores or producers are called primary consumers. Those animals that depend on the primary consumers for food are called secondary consumers and so on. This constitutes the food chain with various trophic levels which clearly indicates who eats whom in the ecosystem and how energy flows. There are various food chains in the ecosystem and each of them do not work in isolation, but are interlinked, making a food web. This unidirectional flow of energy from the sun to producers and then to consumers is what makes the ecosystem function continuously. Energy trapped into an organism does not remain in it forever. It is continuously passed to the next level of the food chain.

The energy does not remain trapped in these levels alone. Once producers and consumers die, they are acted upon by the process of decomposition by decomposers like fungi and bacteria. They break down the complex organic matter of these organisms into the simple inorganic matter and release the trapped energy in the atmosphere.

Based on the feeding relationship with other organisms and the source of nutrition, each organism occupies a particular place in the community or food chain. This place in the food chain is known as a trophic level. Producers belong to the first trophic level, herbivores (primary consumers) to the second and carnivores (secondary consumers) to the third. The amount of energy decreases as one goes up these trophic levels in the food chain.

Q.188 Define decomposition and describe the processes and products of decomposition.

Ans.

Decomposition is defined as the process by which decomposers break down complex organic matter into inorganic substances like carbon dioxide, water and nutrients. The raw material for decomposition is detritus which is nothing but the dead plant remains such as leaves, bark, flowers, dead remains of animals, faecal material, etc. This process requires oxygen and factors that affect the decomposition process are the chemical nature of detritus and climatic factors. Decomposition forms a very important step in the functioning of an ecosystem.

The various processes and products of decomposition are mentioned below:

  1. Fragmentation: The process by which detritus is broken down into smaller particles by the action of detritivores (e.g. earthworm) is called fragmentation. This makes the decomposition process easier and quicker.
  2. Leaching: The process by which water-soluble inorganic nutrients go down into the soil horizon and get precipitated as unavailable salts is called leaching.
  3. Catabolism: The process by which bacterial and fungal enzymes degrade detritus into simpler inorganic substances is called catabolism.
  4. Humification: The process by which dark coloured amorphous substance (humus) accumulates in the soil as a result of decomposition is called humification. This humus is highly resistant to the action of microbes and undergoes further decomposition at a very slow rate.
  5. Mineralisation: The slow process by which humus is further degraded by microbes releasing inorganic nutrients into the soil is called mineralisation.

Q.189 What is primary productivity? Give brief description of factors that affect primary productivity.

Ans

  • Environmental factors like light, temperature, soil, water, precipitation, etc.
  • Availability of nutrients and photosynthetic capacity of the plants.

Q.190 Define ecological pyramids and describe with examples, pyramids of number and biomass.

Ans.

Ecological pyramids are graphical representation or summarization of the trophic structure of an ecosystem. The base of the pyramid depicts the producer trophic level and is usually broad. The apex, which narrows down, is the tertiary or some higher-level consumer and the other consumer levels are depicted in between these two.

Ecological Pyramid

Different ecological parameters like number of organisms at each trophic level (pyramid of number), the biomass of living material (pyramid of biomass) or availability of energy (pyramid of energy) at each trophic level can be depicted by different kinds of ecological pyramids. Let us discuss pyramids of number and pyramids of biomass in detail.

Pyramid of number:

Pyramid of the number represents the number of organisms at each trophic level in a food chain. In most ecosystems, the pyramid of number is upright which means that the members at the successively higher levels are smaller in number with some exceptions where the pyramid of number is inverted. This means that producers are more in number than herbivores and herbivores are more in number than carnivores. A very simple example of a pyramid of number is a representation of the relationship between green grass/herbs/shrubs (producer) with deer (herbivore) and lion (carnivore) in a grassland ecosystem. Another example is of a pond where the lowest trophic level is represented by algae and diatoms, which are the largest in number. The second trophic level is represented by herbivorous zooplanktons which are less abundant in number. While the third and fourth trophic levels are occupied by smaller and larger fish, respectively. There is a considerable reduction in the number of individuals from the base to the top of the pyramid. Thus, as we go up the food chain, the number of organisms at each trophic level decreases in most of the ecosystem resulting in an upright pyramid of the number, if represented graphically. However, in a marine ecosystem, the number of fishes is much more than phytoplankton. Thus it is inverted. The same holds true for the parasitic food chain.

Pyramid of Biomass:

Biomass is the weight of living material at some particular time. To calculate biomass for each trophic level, first an average weight for the organisms at each level is determined, and then the number of organisms at each level is estimated. The average weight is then multiplied with the estimated number which gives the approximate biomass for each trophic level. This kind of pyramid is usually upright in most of the studied ecosystems.

The pyramid of biomass in the sea is usually inverted because the biomass of fishes far exceeds that of phytoplankton.

Q.191 Describe the components of an ecosystem.

Ans.

An ecosystem consists of all the living populations in a given area, along with the physical environment. Thus, an ecosystem consists of both biotic or living and abiotic or nonliving components. There is a continuous interaction that happens between the two components of the ecosystem resulting in a physical structure that is unique for each type of ecosystem. The biotic and the abiotic components function as a unit with respect to the productivity, decomposition, energy flow and nutrient cycle. Let us describe the two components of the ecosystem little in detail:

  1. Biotic component: The living components of the ecosystem can be categorized as either producers or consumers. Producers are autotrophic organisms with the capability of carrying on photosynthesis and making food for themselves. They indirectly make food for other populations. In terrestrial ecosystems, the producers are mainly green plants, while in an aquatic ecosystem, the varied algal species are the major producers. Consumers are heterotrophic organisms that use preformed food. There are 4 types of consumers depending upon the kind of food they consume. Herbivores feed directly on green plants and thus are termed primary consumers e.g. caterpillar feeds on leaves. Carnivores feed only on other animals and thus are secondary consumers e.g. lion feeds on other animals. Omnivores feed on both plants and animals e.g. a human being. The fourth consumers are decomposers, which feed on the remains of plants and animals following their death (detritus) e.g bacteria, fungi, earthworms and convert them into simple inorganic matter. Decomposers form the largest group of the biotic component of the ecosystem.
  2. Abiotic component: The non-living parts of the ecosystem form the abiotic components. The non-living components include soil, water, light, inorganic nutrients, and weather variables. They play a major role in deciding the structure and function of the entire ecosystem.

Q.192 What is the percentage of photosynthetically active radiation (PAR) in the incident solar radiation?
(a) 100%
(b) 50%
(c) 1-5%
(d) 2-10%

Ans.

(b) 50%

Sun is the main source of energy for all ecosystems on Earth. Plants along with photosynthetic and chemosynthetic bacteria (also called autotrophs) capture 2-10% of this photosynthetically active radiation and make food from simple inorganic material.

Q.193 Secondary producers are
(a) Herbivores
(b) Producers
(c) Carnivores
(d) None of the above

Ans.

(d) None of the above

There is no secondary producer. Plants are the only producers. They are autotrophs and synthesize food in the presence of sunlight by performing photosynthesis.

Q.194 The second trophic level in a lake is
(a) Phytoplankton
(b) Zooplankton
(c) Benthos
(d) Fishes

Ans.

(b) Zooplankton

The first level is always plants, as they are the producers.

Q.195 Which one of the following has the largest population in a food chain?
(a) Producers
(b) Primary consumers
(c) Secondary consumers
(d) Decomposers

Ans.

(d) Decomposers

Decomposers are heterotrophic organisms, which meet their energy and nutrient requirements by degrading dead organic matter. Thus, they can act on any level of the food chain.

Q.196 Fill in the blanks:
(a) Plants are called as because they fix carbon dioxide.
(b) In an ecosystem dominated by trees, the pyramid (of numbers) is type.
(c) In aquatic ecosystems, the limiting factor for the productivity is .
(d) Common detritivores in our ecosystem are .
(e) The major reservoir of carbon on earth is .

Ans.

(a) producers

(b) upright

(c) light

(d) earthworm, bacteria and fungi

(e) oceans

Q.197 Consult internet and find out how to make orally active protein pharmaceutical. What is the major problem to be encountered?

Ans.

The orally active protein pharmaceutical are those that can be taken through the oral route. To successfully administer orally active protein pharmaceutical, one needs to put the protein in the form of a tablet whose coating is not affected by the acidic gastric juices. This coating should dissolve only in the intestine, thus releasing the proteins in the intestine from where they can be absorbed by the villi. However, the proteases present in the stomach like pepsin, trypsin and chymotrypsin will act on the orally active protein pharmaceutical and degrade it. The acid of the stomach will denature whatever is remaining after degradation.

The major problem that lies with the development of protein-based pharmaceutical is the fragile nature of the protein and requirement of precise conditions, both in terms of structure as well as surrounding environment, to ensure its activity.

Q.198 Does our blood have proteases and nucleases?

Ans.

No, our blood does not contain proteases and nucleases. In human beings, blood serum contains different types of protease inhibitors, which protect the blood proteins from being broken down by the action of proteases. The enzyme, nucleases, catalyzes the hydrolysis of nucleic acids therefore it is absent in the blood.

Q.199 Find out from internet about golden rice.

Ans.

  • The aim of producing golden rice was to produce a fortified food to be grown and consumed in areas with a shortage of dietary vitamin A. Vitamin A deficiency kills about hundreds and thousands of children under the age of 5 each year.
  • Golden rice is a genetically modified variety of Oryza sativa rice. It has been produced by genetic engineering in such a way that it biosynthesizes beta-carotene, a precursor of vitamin A, in the edible parts of rice. Golden rice differs from its parental strain by the addition of three beta-carotene biosynthesis genes.
  • The scientific details of the rice were first published in journal Science in 2000. It was the product of an eight-year-long project by Dr. Ingo Potrykus of the Swiss Federal Institute of Technology and Dr. Peter Beyer of the University of Freiburg. This was considered a major breakthrough in biotechnology as an entire biosynthetic pathway was altered by scientists.
  • In 2005, a new variety called Golden Rice 2 was announced which produces up to 23 times more beta-carotene than the original golden rice. Although golden rice was developed as a tool to replace dietary supplement of vitamin A, it has met with significant opposition from environmental and anti-globalization activists.

Q.200 Can you suggest a method to remove oil (hydrocarbon) from seeds based on your understanding of rDNA technology and chemistry of oil?

Ans.

Oil consists of glycerols and fatty acids. In order to develop oil-free seeds, one needs to derive a mechanism to silence or inactivate the gene responsible for the production of glycerol and fatty acids. Using rDNA technology the genetic material of an organism can be manipulated to obtain the desired results. Thus, if one wants to get oil-free seeds, genes responsible for the expression of glycerol and fatty acids need to be silenced or inactivated by performing various methods.

For viewing question paper please click here